Incidental Mutation 'R1591:Rufy1'
ID175512
Institutional Source Beutler Lab
Gene Symbol Rufy1
Ensembl Gene ENSMUSG00000020375
Gene NameRUN and FYVE domain containing 1
SynonymsZFYVE12, 3000002E04Rik, Rabip4
MMRRC Submission 039628-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R1591 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50389286-50431125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50394928 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 621 (L621F)
Ref Sequence ENSEMBL: ENSMUSP00000020643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020643]
Predicted Effect probably damaging
Transcript: ENSMUST00000020643
AA Change: L621F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020643
Gene: ENSMUSG00000020375
AA Change: L621F

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 83 111 N/A INTRINSIC
RUN 211 273 1.21e-21 SMART
coiled coil region 324 384 N/A INTRINSIC
coiled coil region 409 621 N/A INTRINSIC
FYVE 638 705 1.24e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135508
Meta Mutation Damage Score 0.0975 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain and a FYVE-type zinc finger domain. The encoded protein binds to phosphatidylinositol-3-phosphate (PI3P) and plays a role in early endosomal trafficking, tethering and fusion through interactions with small GTPases including Rab4, Rab5 and Rab14. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 G T 5: 100,809,639 Q201K probably benign Het
Acacb A T 5: 114,203,423 I829F possibly damaging Het
Acvr1b G T 15: 101,194,024 V62L probably benign Het
Adam6b A T 12: 113,489,832 I90F probably benign Het
Adgrf1 T C 17: 43,310,981 L703P probably damaging Het
Arf3 T C 15: 98,742,788 probably benign Het
Asns T C 6: 7,678,007 D357G probably damaging Het
Atr T C 9: 95,945,385 M2461T probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bod1l T C 5: 41,819,220 I1584V probably benign Het
Bub3 T C 7: 131,561,608 probably null Het
Camkk2 A G 5: 122,757,558 probably null Het
Cand1 G T 10: 119,211,869 T572K possibly damaging Het
Caprin2 A T 6: 148,873,108 S235R possibly damaging Het
Cdh24 T C 14: 54,636,342 T452A probably benign Het
Cdh4 T C 2: 179,886,864 probably null Het
Cfap61 A G 2: 146,145,458 R1060G probably benign Het
Chd9 A G 8: 90,983,538 D314G probably damaging Het
Csmd1 T A 8: 15,900,710 I3500F probably damaging Het
Dnah1 G T 14: 31,272,332 Q2858K probably benign Het
Dnah6 C T 6: 73,076,600 E2884K probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Exosc10 T A 4: 148,568,383 I485N probably benign Het
Fap T C 2: 62,553,857 K2E probably damaging Het
Fgfr1 G A 8: 25,572,720 G671D probably damaging Het
Fzr1 C T 10: 81,370,367 R162Q possibly damaging Het
Gm17727 T C 9: 35,776,656 D96G probably damaging Het
Grap2 A T 15: 80,648,448 Y272F probably damaging Het
Il11ra1 T A 4: 41,766,200 W246R probably damaging Het
Kcna3 A T 3: 107,037,029 I203F probably damaging Het
Kcng1 T C 2: 168,268,710 E178G possibly damaging Het
Kif19a A C 11: 114,789,231 H798P probably benign Het
Kif21b T C 1: 136,149,317 L359P probably damaging Het
Krt6a A T 15: 101,692,357 probably null Het
Lman1l C T 9: 57,615,802 V125I probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrp3 A G 7: 35,202,365 V676A probably benign Het
Lrrc63 T A 14: 75,125,892 K266N possibly damaging Het
Mccc1 C T 3: 35,989,857 V246M probably damaging Het
Mdn1 T C 4: 32,700,092 V1395A possibly damaging Het
Mmrn1 A T 6: 60,944,771 R71* probably null Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Ogdh T C 11: 6,349,384 F750S probably damaging Het
Olfr147 A G 9: 38,402,936 T18A probably damaging Het
Olfr356 C A 2: 36,937,978 N286K probably damaging Het
Olfr484 T A 7: 108,124,364 I300F possibly damaging Het
Olfr612 T G 7: 103,539,067 T56P probably benign Het
Olfr901 A T 9: 38,430,411 N43I probably damaging Het
Osbpl11 A C 16: 33,209,983 I194L probably benign Het
Pacsin2 T C 15: 83,385,051 E14G probably damaging Het
Pcdh7 A G 5: 57,720,422 T440A probably damaging Het
Pcdhb17 T C 18: 37,485,825 S223P probably damaging Het
Pik3c2g G A 6: 139,748,178 R109K probably benign Het
Ppp2ca T C 11: 52,099,089 I14T possibly damaging Het
Rdh12 A T 12: 79,211,504 T102S probably damaging Het
Rsf1 T A 7: 97,639,313 C132* probably null Het
Ruvbl2 C T 7: 45,424,711 R253H possibly damaging Het
Sdf2 A G 11: 78,254,993 E172G probably damaging Het
Skint5 C T 4: 113,999,454 probably null Het
Slc25a27 A G 17: 43,653,424 I185T probably benign Het
Slc41a3 A C 6: 90,633,695 K180Q probably benign Het
Slc7a14 A C 3: 31,237,449 F227V probably damaging Het
Smg1 T C 7: 118,156,919 probably benign Het
St6galnac1 A T 11: 116,765,863 D483E probably damaging Het
Tes A G 6: 17,097,442 K183R probably damaging Het
Tgfbr1 G T 4: 47,403,471 D290Y probably damaging Het
Tifab T A 13: 56,176,351 Y93F probably benign Het
Tmem131l A G 3: 83,940,889 probably null Het
Tnfrsf21 T A 17: 43,085,374 S516R probably benign Het
Ttn T C 2: 76,776,045 Y18140C probably damaging Het
Unc13b T A 4: 43,244,747 S3692T probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfp113 T C 5: 138,151,197 probably benign Het
Zfp26 T C 9: 20,437,625 T548A probably benign Het
Zfp870 C T 17: 32,884,016 G114D probably damaging Het
Other mutations in Rufy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Rufy1 APN 11 50392023 missense probably damaging 1.00
IGL01640:Rufy1 APN 11 50390378 unclassified probably benign
IGL01829:Rufy1 APN 11 50416244 nonsense probably null
IGL02559:Rufy1 APN 11 50420483 missense probably damaging 1.00
IGL03409:Rufy1 APN 11 50406483 missense probably benign 0.00
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0193:Rufy1 UTSW 11 50389852 missense probably benign 0.12
R1028:Rufy1 UTSW 11 50414598 intron probably null
R1818:Rufy1 UTSW 11 50414572 missense probably benign 0.43
R1952:Rufy1 UTSW 11 50406406 missense probably benign 0.01
R2228:Rufy1 UTSW 11 50397784 splice site probably null
R2982:Rufy1 UTSW 11 50419708 missense possibly damaging 0.77
R4837:Rufy1 UTSW 11 50401493 missense probably damaging 0.96
R4874:Rufy1 UTSW 11 50406450 missense possibly damaging 0.80
R4959:Rufy1 UTSW 11 50401488 missense probably benign
R4968:Rufy1 UTSW 11 50410607 missense probably benign 0.01
R5204:Rufy1 UTSW 11 50406434 missense probably damaging 1.00
R5426:Rufy1 UTSW 11 50421734 missense probably damaging 1.00
R5966:Rufy1 UTSW 11 50401488 missense probably benign
R6129:Rufy1 UTSW 11 50417248 missense probably damaging 0.99
R6930:Rufy1 UTSW 11 50398380 missense probably benign 0.05
R7073:Rufy1 UTSW 11 50404463 missense probably benign 0.05
R7462:Rufy1 UTSW 11 50407828 missense possibly damaging 0.93
R7646:Rufy1 UTSW 11 50410609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCACAATTCCCCAAGGCTCTG -3'
(R):5'- GGTGTGAAGTCATCCACCCACAAG -3'

Sequencing Primer
(F):5'- CAAGGCTCTGGTCATGAGG -3'
(R):5'- gtcaTCCACCCACAAGAGATGATAG -3'
Posted On2014-04-24