Incidental Mutation 'R1591:Dnah1'
ID175520
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission 039628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1591 (G1)
Quality Score116
Status Validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31272332 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 2858 (Q2858K)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably benign
Transcript: ENSMUST00000048603
AA Change: Q2858K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: Q2858K

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228927
Meta Mutation Damage Score 0.0810 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 G T 5: 100,809,639 Q201K probably benign Het
Acacb A T 5: 114,203,423 I829F possibly damaging Het
Acvr1b G T 15: 101,194,024 V62L probably benign Het
Adam6b A T 12: 113,489,832 I90F probably benign Het
Adgrf1 T C 17: 43,310,981 L703P probably damaging Het
Arf3 T C 15: 98,742,788 probably benign Het
Asns T C 6: 7,678,007 D357G probably damaging Het
Atr T C 9: 95,945,385 M2461T probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bod1l T C 5: 41,819,220 I1584V probably benign Het
Bub3 T C 7: 131,561,608 probably null Het
Camkk2 A G 5: 122,757,558 probably null Het
Cand1 G T 10: 119,211,869 T572K possibly damaging Het
Caprin2 A T 6: 148,873,108 S235R possibly damaging Het
Cdh24 T C 14: 54,636,342 T452A probably benign Het
Cdh4 T C 2: 179,886,864 probably null Het
Cfap61 A G 2: 146,145,458 R1060G probably benign Het
Chd9 A G 8: 90,983,538 D314G probably damaging Het
Csmd1 T A 8: 15,900,710 I3500F probably damaging Het
Dnah6 C T 6: 73,076,600 E2884K probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Exosc10 T A 4: 148,568,383 I485N probably benign Het
Fap T C 2: 62,553,857 K2E probably damaging Het
Fgfr1 G A 8: 25,572,720 G671D probably damaging Het
Fzr1 C T 10: 81,370,367 R162Q possibly damaging Het
Gm17727 T C 9: 35,776,656 D96G probably damaging Het
Grap2 A T 15: 80,648,448 Y272F probably damaging Het
Il11ra1 T A 4: 41,766,200 W246R probably damaging Het
Kcna3 A T 3: 107,037,029 I203F probably damaging Het
Kcng1 T C 2: 168,268,710 E178G possibly damaging Het
Kif19a A C 11: 114,789,231 H798P probably benign Het
Kif21b T C 1: 136,149,317 L359P probably damaging Het
Krt6a A T 15: 101,692,357 probably null Het
Lman1l C T 9: 57,615,802 V125I probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrp3 A G 7: 35,202,365 V676A probably benign Het
Lrrc63 T A 14: 75,125,892 K266N possibly damaging Het
Mccc1 C T 3: 35,989,857 V246M probably damaging Het
Mdn1 T C 4: 32,700,092 V1395A possibly damaging Het
Mmrn1 A T 6: 60,944,771 R71* probably null Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Ogdh T C 11: 6,349,384 F750S probably damaging Het
Olfr147 A G 9: 38,402,936 T18A probably damaging Het
Olfr356 C A 2: 36,937,978 N286K probably damaging Het
Olfr484 T A 7: 108,124,364 I300F possibly damaging Het
Olfr612 T G 7: 103,539,067 T56P probably benign Het
Olfr901 A T 9: 38,430,411 N43I probably damaging Het
Osbpl11 A C 16: 33,209,983 I194L probably benign Het
Pacsin2 T C 15: 83,385,051 E14G probably damaging Het
Pcdh7 A G 5: 57,720,422 T440A probably damaging Het
Pcdhb17 T C 18: 37,485,825 S223P probably damaging Het
Pik3c2g G A 6: 139,748,178 R109K probably benign Het
Ppp2ca T C 11: 52,099,089 I14T possibly damaging Het
Rdh12 A T 12: 79,211,504 T102S probably damaging Het
Rsf1 T A 7: 97,639,313 C132* probably null Het
Rufy1 G A 11: 50,394,928 L621F probably damaging Het
Ruvbl2 C T 7: 45,424,711 R253H possibly damaging Het
Sdf2 A G 11: 78,254,993 E172G probably damaging Het
Skint5 C T 4: 113,999,454 probably null Het
Slc25a27 A G 17: 43,653,424 I185T probably benign Het
Slc41a3 A C 6: 90,633,695 K180Q probably benign Het
Slc7a14 A C 3: 31,237,449 F227V probably damaging Het
Smg1 T C 7: 118,156,919 probably benign Het
St6galnac1 A T 11: 116,765,863 D483E probably damaging Het
Tes A G 6: 17,097,442 K183R probably damaging Het
Tgfbr1 G T 4: 47,403,471 D290Y probably damaging Het
Tifab T A 13: 56,176,351 Y93F probably benign Het
Tmem131l A G 3: 83,940,889 probably null Het
Tnfrsf21 T A 17: 43,085,374 S516R probably benign Het
Ttn T C 2: 76,776,045 Y18140C probably damaging Het
Unc13b T A 4: 43,244,747 S3692T probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfp113 T C 5: 138,151,197 probably benign Het
Zfp26 T C 9: 20,437,625 T548A probably benign Het
Zfp870 C T 17: 32,884,016 G114D probably damaging Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
Faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31274382 missense probably benign
R7241:Dnah1 UTSW 14 31264939 missense probably benign 0.00
R7260:Dnah1 UTSW 14 31269386 missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31269894 missense probably benign
R7291:Dnah1 UTSW 14 31298705 missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31287863 missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31269841 missense probably benign 0.05
R7319:Dnah1 UTSW 14 31296594 missense probably benign 0.02
R7323:Dnah1 UTSW 14 31298707 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31261590 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31300791 missense possibly damaging 0.80
R7499:Dnah1 UTSW 14 31315122 nonsense probably null
R7526:Dnah1 UTSW 14 31287876 missense possibly damaging 0.49
R7560:Dnah1 UTSW 14 31304983 missense probably benign
R7574:Dnah1 UTSW 14 31319908 missense probably benign 0.00
R7617:Dnah1 UTSW 14 31284782 missense possibly damaging 0.80
R7620:Dnah1 UTSW 14 31303906 missense possibly damaging 0.47
R7692:Dnah1 UTSW 14 31292338 missense probably benign 0.00
R7702:Dnah1 UTSW 14 31310909 missense probably benign
R7786:Dnah1 UTSW 14 31262521 missense probably damaging 1.00
R7984:Dnah1 UTSW 14 31267815 missense probably damaging 1.00
R8002:Dnah1 UTSW 14 31298722 missense probably damaging 1.00
R8022:Dnah1 UTSW 14 31265014 missense probably damaging 1.00
R8032:Dnah1 UTSW 14 31271548 missense probably damaging 1.00
R8099:Dnah1 UTSW 14 31302364 missense probably benign 0.00
R8171:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R8263:Dnah1 UTSW 14 31293177 missense probably damaging 1.00
R8274:Dnah1 UTSW 14 31295574 missense probably benign 0.00
R8345:Dnah1 UTSW 14 31264594 missense probably damaging 1.00
R8348:Dnah1 UTSW 14 31293725 missense probably damaging 1.00
R8353:Dnah1 UTSW 14 31283202 missense probably benign
R8356:Dnah1 UTSW 14 31273015 missense probably benign 0.00
R8376:Dnah1 UTSW 14 31301346 missense probably damaging 1.00
R8448:Dnah1 UTSW 14 31293725 missense probably damaging 1.00
R8461:Dnah1 UTSW 14 31305958 missense probably benign 0.00
R8534:Dnah1 UTSW 14 31301848 missense probably benign 0.16
R8544:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R8679:Dnah1 UTSW 14 31267810 missense possibly damaging 0.77
R8716:Dnah1 UTSW 14 31267984 critical splice donor site probably benign
R8750:Dnah1 UTSW 14 31304967 missense probably benign 0.30
R8790:Dnah1 UTSW 14 31296275 missense possibly damaging 0.89
R8808:Dnah1 UTSW 14 31286814 missense probably benign
R8821:Dnah1 UTSW 14 31296498 missense probably benign
R8887:Dnah1 UTSW 14 31311040 missense probably damaging 1.00
R8948:Dnah1 UTSW 14 31290439 missense probably damaging 1.00
R8950:Dnah1 UTSW 14 31290439 missense probably damaging 1.00
R8955:Dnah1 UTSW 14 31285993 missense probably benign
RF006:Dnah1 UTSW 14 31307875 missense probably benign 0.08
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTGAGCTGTGACATCATCAATGCC -3'
(R):5'- TAGAAACCACTGAGCAACCTGGGG -3'

Sequencing Primer
(F):5'- TTCATAGATGCCCGGCCAAAG -3'
(R):5'- GGTttttgttttgttttgttttgttc -3'
Posted On2014-04-24