Incidental Mutation 'R1591:B3galt4'
ID175531
Institutional Source Beutler Lab
Gene Symbol B3galt4
Ensembl Gene ENSMUSG00000067370
Gene NameUDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
SynonymsGal-T2
MMRRC Submission 039628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1591 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33949909-33951477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33950839 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 142 (R142C)
Ref Sequence ENSEMBL: ENSMUSP00000084823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008812] [ENSMUST00000025170] [ENSMUST00000025178] [ENSMUST00000087543] [ENSMUST00000174609]
Predicted Effect probably benign
Transcript: ENSMUST00000008812
SMART Domains Protein: ENSMUSP00000008812
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 142 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025178
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087543
AA Change: R142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084823
Gene: ENSMUSG00000067370
AA Change: R142C

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Galactosyl_T 85 302 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174175
Predicted Effect probably benign
Transcript: ENSMUST00000174609
SMART Domains Protein: ENSMUSP00000138296
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 107 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174758
Meta Mutation Damage Score 0.4813 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is oriented telomere to centromere in close proximity to the ribosomal protein S18 gene. The functionality of the encoded protein is limited to ganglioseries glycolipid biosynthesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 G T 5: 100,809,639 Q201K probably benign Het
Acacb A T 5: 114,203,423 I829F possibly damaging Het
Acvr1b G T 15: 101,194,024 V62L probably benign Het
Adam6b A T 12: 113,489,832 I90F probably benign Het
Adgrf1 T C 17: 43,310,981 L703P probably damaging Het
Arf3 T C 15: 98,742,788 probably benign Het
Asns T C 6: 7,678,007 D357G probably damaging Het
Atr T C 9: 95,945,385 M2461T probably damaging Het
Bod1l T C 5: 41,819,220 I1584V probably benign Het
Bub3 T C 7: 131,561,608 probably null Het
Camkk2 A G 5: 122,757,558 probably null Het
Cand1 G T 10: 119,211,869 T572K possibly damaging Het
Caprin2 A T 6: 148,873,108 S235R possibly damaging Het
Cdh24 T C 14: 54,636,342 T452A probably benign Het
Cdh4 T C 2: 179,886,864 probably null Het
Cfap61 A G 2: 146,145,458 R1060G probably benign Het
Chd9 A G 8: 90,983,538 D314G probably damaging Het
Csmd1 T A 8: 15,900,710 I3500F probably damaging Het
Dnah1 G T 14: 31,272,332 Q2858K probably benign Het
Dnah6 C T 6: 73,076,600 E2884K probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Exosc10 T A 4: 148,568,383 I485N probably benign Het
Fap T C 2: 62,553,857 K2E probably damaging Het
Fgfr1 G A 8: 25,572,720 G671D probably damaging Het
Fzr1 C T 10: 81,370,367 R162Q possibly damaging Het
Gm17727 T C 9: 35,776,656 D96G probably damaging Het
Grap2 A T 15: 80,648,448 Y272F probably damaging Het
Il11ra1 T A 4: 41,766,200 W246R probably damaging Het
Kcna3 A T 3: 107,037,029 I203F probably damaging Het
Kcng1 T C 2: 168,268,710 E178G possibly damaging Het
Kif19a A C 11: 114,789,231 H798P probably benign Het
Kif21b T C 1: 136,149,317 L359P probably damaging Het
Krt6a A T 15: 101,692,357 probably null Het
Lman1l C T 9: 57,615,802 V125I probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrp3 A G 7: 35,202,365 V676A probably benign Het
Lrrc63 T A 14: 75,125,892 K266N possibly damaging Het
Mccc1 C T 3: 35,989,857 V246M probably damaging Het
Mdn1 T C 4: 32,700,092 V1395A possibly damaging Het
Mmrn1 A T 6: 60,944,771 R71* probably null Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Ogdh T C 11: 6,349,384 F750S probably damaging Het
Olfr147 A G 9: 38,402,936 T18A probably damaging Het
Olfr356 C A 2: 36,937,978 N286K probably damaging Het
Olfr484 T A 7: 108,124,364 I300F possibly damaging Het
Olfr612 T G 7: 103,539,067 T56P probably benign Het
Olfr901 A T 9: 38,430,411 N43I probably damaging Het
Osbpl11 A C 16: 33,209,983 I194L probably benign Het
Pacsin2 T C 15: 83,385,051 E14G probably damaging Het
Pcdh7 A G 5: 57,720,422 T440A probably damaging Het
Pcdhb17 T C 18: 37,485,825 S223P probably damaging Het
Pik3c2g G A 6: 139,748,178 R109K probably benign Het
Ppp2ca T C 11: 52,099,089 I14T possibly damaging Het
Rdh12 A T 12: 79,211,504 T102S probably damaging Het
Rsf1 T A 7: 97,639,313 C132* probably null Het
Rufy1 G A 11: 50,394,928 L621F probably damaging Het
Ruvbl2 C T 7: 45,424,711 R253H possibly damaging Het
Sdf2 A G 11: 78,254,993 E172G probably damaging Het
Skint5 C T 4: 113,999,454 probably null Het
Slc25a27 A G 17: 43,653,424 I185T probably benign Het
Slc41a3 A C 6: 90,633,695 K180Q probably benign Het
Slc7a14 A C 3: 31,237,449 F227V probably damaging Het
Smg1 T C 7: 118,156,919 probably benign Het
St6galnac1 A T 11: 116,765,863 D483E probably damaging Het
Tes A G 6: 17,097,442 K183R probably damaging Het
Tgfbr1 G T 4: 47,403,471 D290Y probably damaging Het
Tifab T A 13: 56,176,351 Y93F probably benign Het
Tmem131l A G 3: 83,940,889 probably null Het
Tnfrsf21 T A 17: 43,085,374 S516R probably benign Het
Ttn T C 2: 76,776,045 Y18140C probably damaging Het
Unc13b T A 4: 43,244,747 S3692T probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfp113 T C 5: 138,151,197 probably benign Het
Zfp26 T C 9: 20,437,625 T548A probably benign Het
Zfp870 C T 17: 32,884,016 G114D probably damaging Het
Other mutations in B3galt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:B3galt4 APN 17 33951213 missense probably benign 0.23
IGL02216:B3galt4 APN 17 33950565 missense probably damaging 1.00
R0326:B3galt4 UTSW 17 33950748 missense probably damaging 1.00
R0419:B3galt4 UTSW 17 33950790 missense probably damaging 1.00
R0446:B3galt4 UTSW 17 33951018 missense probably benign 0.00
R1024:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R1028:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R1412:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R1590:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R1681:B3galt4 UTSW 17 33951213 missense probably benign 0.23
R1851:B3galt4 UTSW 17 33950911 missense probably benign 0.26
R1955:B3galt4 UTSW 17 33950632 nonsense probably null
R2103:B3galt4 UTSW 17 33950839 missense probably damaging 1.00
R5802:B3galt4 UTSW 17 33950757 missense probably damaging 1.00
R6922:B3galt4 UTSW 17 33950847 missense probably damaging 1.00
R7644:B3galt4 UTSW 17 33950445 missense probably damaging 0.99
R8073:B3galt4 UTSW 17 33950823 missense probably damaging 1.00
Z1177:B3galt4 UTSW 17 33951136 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGCCTAAATACAGAAGGGGCAC -3'
(R):5'- AGAGAAACGCCATTCGGGCATC -3'

Sequencing Primer
(F):5'- AGAAGGGGCACTGCCTG -3'
(R):5'- TCTTGGGGTGCCATCCG -3'
Posted On2014-04-24