Incidental Mutation 'R1594:D630003M21Rik'
ID175542
Institutional Source Beutler Lab
Gene Symbol D630003M21Rik
Ensembl Gene ENSMUSG00000037813
Gene NameRIKEN cDNA D630003M21 gene
Synonyms
MMRRC Submission 039631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1594 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158182533-158229222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158211630 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 646 (Q646L)
Ref Sequence ENSEMBL: ENSMUSP00000040546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046944] [ENSMUST00000103121] [ENSMUST00000169335]
Predicted Effect probably damaging
Transcript: ENSMUST00000046944
AA Change: Q646L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040546
Gene: ENSMUSG00000037813
AA Change: Q646L

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 1e-6 BLAST
SCOP:d1aua_2 567 711 5e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103121
AA Change: Q646L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: Q646L

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169335
AA Change: Q646L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: Q646L

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Meta Mutation Damage Score 0.1624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 G A 16: 31,127,387 A264V probably benign Het
Adam17 A G 12: 21,340,470 probably null Het
Adcy10 A G 1: 165,525,033 N479D probably benign Het
C2cd2l A G 9: 44,316,773 S84P probably damaging Het
Capn13 A G 17: 73,351,479 V198A probably benign Het
Cblc G A 7: 19,792,546 S206F probably damaging Het
Ccdc7b A T 8: 129,178,357 T159S possibly damaging Het
Clpx A G 9: 65,324,270 T546A probably damaging Het
Col18a1 A G 10: 77,113,036 V214A possibly damaging Het
Csgalnact1 A T 8: 68,358,632 V462E probably damaging Het
Cts6 G A 13: 61,198,367 T202I probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
E2f2 A G 4: 136,186,830 Q297R possibly damaging Het
Eef1d T C 15: 75,896,346 E189G probably damaging Het
Fam114a2 A C 11: 57,513,240 probably null Het
Fam24b A C 7: 131,326,296 Y55D probably benign Het
Gimap6 T C 6: 48,702,191 T304A probably benign Het
Gm11232 T C 4: 71,757,335 E63G possibly damaging Het
Hbs1l A G 10: 21,352,023 M152V probably benign Het
Herc3 C A 6: 58,887,584 probably benign Het
Hmx2 A G 7: 131,555,502 D115G probably benign Het
Igsf3 C A 3: 101,451,077 Y761* probably null Het
Kbtbd13 A G 9: 65,391,619 W12R probably benign Het
Kif2c C A 4: 117,178,188 R21L probably benign Het
Kmt2c T C 5: 25,314,878 N2078S probably benign Het
Mgst3 T A 1: 167,373,810 Y102F probably damaging Het
Mov10 G T 3: 104,795,411 T946N probably damaging Het
Nbeal1 T A 1: 60,305,291 I2317N possibly damaging Het
Nid2 T A 14: 19,781,261 I741N probably benign Het
Nlrp9a G A 7: 26,570,507 W786* probably null Het
Olfr44 A C 9: 39,484,746 I166S probably benign Het
Olfr461 T C 6: 40,544,347 I211V probably benign Het
Pi4ka G T 16: 17,373,419 probably benign Het
Plcb4 A G 2: 135,970,390 probably benign Het
Psg16 A G 7: 17,093,823 T144A probably damaging Het
Sec24b A G 3: 129,991,351 V1002A probably benign Het
Shank1 A T 7: 44,327,223 K582* probably null Het
Slc22a7 T C 17: 46,438,031 D120G possibly damaging Het
Slco6c1 T A 1: 97,062,438 T676S probably benign Het
Sulf2 A G 2: 166,084,447 probably benign Het
Tgm1 T C 14: 55,709,519 D344G probably damaging Het
Tle4 C T 19: 14,453,606 W604* probably null Het
Tmco3 T C 8: 13,292,052 S109P probably damaging Het
Unc13d T G 11: 116,068,712 D647A probably benign Het
Usp19 T C 9: 108,498,522 V887A probably damaging Het
Vmn2r49 A T 7: 9,976,623 D727E probably damaging Het
Ypel1 A G 16: 17,082,121 H72R probably damaging Het
Zfp407 A G 18: 84,209,331 V2051A probably benign Het
Zfp438 A G 18: 5,213,515 L481P possibly damaging Het
Zfp850 C A 7: 27,989,391 R464L probably benign Het
Zfp985 T C 4: 147,583,080 V135A probably benign Het
Other mutations in D630003M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D630003M21Rik APN 2 158213412 missense possibly damaging 0.92
IGL01447:D630003M21Rik APN 2 158217356 missense probably benign
IGL01501:D630003M21Rik APN 2 158201067 missense probably benign 0.03
IGL01874:D630003M21Rik APN 2 158204724 missense probably damaging 1.00
IGL02116:D630003M21Rik APN 2 158203210 missense possibly damaging 0.76
IGL02212:D630003M21Rik APN 2 158210171 missense probably benign 0.02
IGL02477:D630003M21Rik APN 2 158217488 missense probably benign 0.44
IGL02644:D630003M21Rik APN 2 158216810 missense possibly damaging 0.87
IGL02861:D630003M21Rik APN 2 158200998 missense probably benign 0.03
IGL02896:D630003M21Rik APN 2 158217285 missense probably benign 0.00
IGL03089:D630003M21Rik APN 2 158216744 missense probably benign
IGL03148:D630003M21Rik APN 2 158217224 missense probably damaging 1.00
ANU05:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
ANU18:D630003M21Rik UTSW 2 158217648 missense probably benign
F5770:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
R0113:D630003M21Rik UTSW 2 158196575 missense possibly damaging 0.92
R0147:D630003M21Rik UTSW 2 158203067 splice site probably benign
R0513:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R0637:D630003M21Rik UTSW 2 158195407 intron probably benign
R1774:D630003M21Rik UTSW 2 158220470 missense probably damaging 1.00
R1823:D630003M21Rik UTSW 2 158217557 missense probably damaging 1.00
R1864:D630003M21Rik UTSW 2 158203185 missense probably damaging 1.00
R1983:D630003M21Rik UTSW 2 158208421 missense probably benign 0.34
R2042:D630003M21Rik UTSW 2 158215849 missense probably damaging 1.00
R2259:D630003M21Rik UTSW 2 158204711 missense probably damaging 1.00
R2350:D630003M21Rik UTSW 2 158201011 missense probably damaging 0.96
R3157:D630003M21Rik UTSW 2 158195472 intron probably benign
R3937:D630003M21Rik UTSW 2 158200360 missense probably damaging 1.00
R4124:D630003M21Rik UTSW 2 158196593 missense probably damaging 0.97
R4437:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4473:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4513:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4514:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4729:D630003M21Rik UTSW 2 158216703 missense probably damaging 1.00
R4794:D630003M21Rik UTSW 2 158196139 missense probably benign
R4947:D630003M21Rik UTSW 2 158186196 missense unknown
R5005:D630003M21Rik UTSW 2 158211643 missense possibly damaging 0.87
R5022:D630003M21Rik UTSW 2 158217633 missense probably damaging 0.99
R5167:D630003M21Rik UTSW 2 158205745 missense probably damaging 1.00
R5191:D630003M21Rik UTSW 2 158201035 missense probably benign 0.06
R5488:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5489:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5495:D630003M21Rik UTSW 2 158220511 missense possibly damaging 0.69
R5708:D630003M21Rik UTSW 2 158220392 splice site probably null
R5770:D630003M21Rik UTSW 2 158195580 intron probably benign
R5789:D630003M21Rik UTSW 2 158216814 missense possibly damaging 0.63
R5817:D630003M21Rik UTSW 2 158196493 missense probably damaging 1.00
R5898:D630003M21Rik UTSW 2 158204657 splice site probably null
R5969:D630003M21Rik UTSW 2 158217708 missense probably damaging 1.00
R6084:D630003M21Rik UTSW 2 158217584 missense probably damaging 0.99
R6111:D630003M21Rik UTSW 2 158213448 missense probably damaging 1.00
R6225:D630003M21Rik UTSW 2 158217401 missense probably benign 0.23
R6307:D630003M21Rik UTSW 2 158215951 missense probably benign 0.34
R6350:D630003M21Rik UTSW 2 158220495 missense probably damaging 1.00
R6548:D630003M21Rik UTSW 2 158205699 critical splice donor site probably null
R6583:D630003M21Rik UTSW 2 158220516 missense probably damaging 0.98
R6821:D630003M21Rik UTSW 2 158204774 missense probably damaging 1.00
R6963:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R7021:D630003M21Rik UTSW 2 158216750 missense possibly damaging 0.59
R7210:D630003M21Rik UTSW 2 158216012 critical splice acceptor site probably null
R7345:D630003M21Rik UTSW 2 158217209 missense probably damaging 1.00
R7355:D630003M21Rik UTSW 2 158200224 missense probably damaging 1.00
R7514:D630003M21Rik UTSW 2 158217353 missense probably damaging 1.00
R7587:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
R7587:D630003M21Rik UTSW 2 158201056 missense probably damaging 1.00
R7713:D630003M21Rik UTSW 2 158216778 nonsense probably null
R7792:D630003M21Rik UTSW 2 158210162 missense possibly damaging 0.94
R7819:D630003M21Rik UTSW 2 158216798 missense probably damaging 0.97
R7832:D630003M21Rik UTSW 2 158217668 missense probably damaging 1.00
R8115:D630003M21Rik UTSW 2 158216590 missense probably benign 0.23
V7580:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7581:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7583:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGGAGCCATTCCATTCATAGCTTGC -3'
(R):5'- GAACAATCTGGAGTCCTGCCTACAC -3'

Sequencing Primer
(F):5'- ATAGCTTGCTTTCCAGGACTCG -3'
(R):5'- CTTAGAACTCTGGGAATGGAACAC -3'
Posted On2014-04-24