Incidental Mutation 'R1594:Gimap6'
ID175554
Institutional Source Beutler Lab
Gene Symbol Gimap6
Ensembl Gene ENSMUSG00000047867
Gene NameGTPase, IMAP family member 6
Synonyms4833419H03Rik, Ian6
MMRRC Submission 039631-MU
Accession Numbers

Genbank: NM_153175; MGI: 1918876

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1594 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48701582-48708225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48702191 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 304 (T304A)
Ref Sequence ENSEMBL: ENSMUSP00000059371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053661] [ENSMUST00000119315] [ENSMUST00000126422]
Predicted Effect probably benign
Transcript: ENSMUST00000053661
AA Change: T304A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059371
Gene: ENSMUSG00000047867
AA Change: T304A

DomainStartEndE-ValueType
low complexity region 66 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
Pfam:AIG1 104 303 7.7e-73 PFAM
Pfam:MMR_HSR1 105 226 2.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119315
SMART Domains Protein: ENSMUSP00000113918
Gene: ENSMUSG00000047867

DomainStartEndE-ValueType
low complexity region 66 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126422
SMART Domains Protein: ENSMUSP00000145325
Gene: ENSMUSG00000047867

DomainStartEndE-ValueType
low complexity region 66 71 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132725
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 G A 16: 31,127,387 A264V probably benign Het
Adam17 A G 12: 21,340,470 probably null Het
Adcy10 A G 1: 165,525,033 N479D probably benign Het
C2cd2l A G 9: 44,316,773 S84P probably damaging Het
Capn13 A G 17: 73,351,479 V198A probably benign Het
Cblc G A 7: 19,792,546 S206F probably damaging Het
Ccdc7b A T 8: 129,178,357 T159S possibly damaging Het
Clpx A G 9: 65,324,270 T546A probably damaging Het
Col18a1 A G 10: 77,113,036 V214A possibly damaging Het
Csgalnact1 A T 8: 68,358,632 V462E probably damaging Het
Cts6 G A 13: 61,198,367 T202I probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
D630003M21Rik T A 2: 158,211,630 Q646L probably damaging Het
E2f2 A G 4: 136,186,830 Q297R possibly damaging Het
Eef1d T C 15: 75,896,346 E189G probably damaging Het
Fam114a2 A C 11: 57,513,240 probably null Het
Fam24b A C 7: 131,326,296 Y55D probably benign Het
Gm11232 T C 4: 71,757,335 E63G possibly damaging Het
Hbs1l A G 10: 21,352,023 M152V probably benign Het
Herc3 C A 6: 58,887,584 probably benign Het
Hmx2 A G 7: 131,555,502 D115G probably benign Het
Igsf3 C A 3: 101,451,077 Y761* probably null Het
Kbtbd13 A G 9: 65,391,619 W12R probably benign Het
Kif2c C A 4: 117,178,188 R21L probably benign Het
Kmt2c T C 5: 25,314,878 N2078S probably benign Het
Mgst3 T A 1: 167,373,810 Y102F probably damaging Het
Mov10 G T 3: 104,795,411 T946N probably damaging Het
Nbeal1 T A 1: 60,305,291 I2317N possibly damaging Het
Nid2 T A 14: 19,781,261 I741N probably benign Het
Nlrp9a G A 7: 26,570,507 W786* probably null Het
Olfr44 A C 9: 39,484,746 I166S probably benign Het
Olfr461 T C 6: 40,544,347 I211V probably benign Het
Pi4ka G T 16: 17,373,419 probably benign Het
Plcb4 A G 2: 135,970,390 probably benign Het
Psg16 A G 7: 17,093,823 T144A probably damaging Het
Sec24b A G 3: 129,991,351 V1002A probably benign Het
Shank1 A T 7: 44,327,223 K582* probably null Het
Slc22a7 T C 17: 46,438,031 D120G possibly damaging Het
Slco6c1 T A 1: 97,062,438 T676S probably benign Het
Sulf2 A G 2: 166,084,447 probably benign Het
Tgm1 T C 14: 55,709,519 D344G probably damaging Het
Tle4 C T 19: 14,453,606 W604* probably null Het
Tmco3 T C 8: 13,292,052 S109P probably damaging Het
Unc13d T G 11: 116,068,712 D647A probably benign Het
Usp19 T C 9: 108,498,522 V887A probably damaging Het
Vmn2r49 A T 7: 9,976,623 D727E probably damaging Het
Ypel1 A G 16: 17,082,121 H72R probably damaging Het
Zfp407 A G 18: 84,209,331 V2051A probably benign Het
Zfp438 A G 18: 5,213,515 L481P possibly damaging Het
Zfp850 C A 7: 27,989,391 R464L probably benign Het
Zfp985 T C 4: 147,583,080 V135A probably benign Het
Other mutations in Gimap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Gimap6 APN 6 48702421 missense possibly damaging 0.91
IGL00896:Gimap6 APN 6 48702460 missense probably benign 0.12
IGL02126:Gimap6 APN 6 48702701 missense probably damaging 1.00
IGL02450:Gimap6 APN 6 48704417 missense probably benign 0.07
IGL02493:Gimap6 APN 6 48702669 missense probably damaging 0.99
IGL02601:Gimap6 APN 6 48702475 missense probably damaging 1.00
N/A:Gimap6 UTSW 6 48702415 missense probably damaging 0.99
PIT4515001:Gimap6 UTSW 6 48702568 missense probably benign 0.00
PIT4519001:Gimap6 UTSW 6 48708061 missense probably benign 0.06
R0066:Gimap6 UTSW 6 48702470 missense probably damaging 1.00
R0066:Gimap6 UTSW 6 48702470 missense probably damaging 1.00
R2233:Gimap6 UTSW 6 48704484 missense possibly damaging 0.92
R4982:Gimap6 UTSW 6 48707999 missense probably benign 0.03
R5664:Gimap6 UTSW 6 48702275 missense probably benign 0.01
R6235:Gimap6 UTSW 6 48702457 missense probably benign 0.00
R7469:Gimap6 UTSW 6 48702458 missense probably benign 0.00
R7997:Gimap6 UTSW 6 48702315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATTGCAGCAAAGTCTCTCAAG -3'
(R):5'- TTCTGGTGTTCACCCGGAAGGAAG -3'

Sequencing Primer
(F):5'- ctcttcacagcaatagaacactgac -3'
(R):5'- CAATAAGAGCCTGGATGTTCTG -3'
Posted On2014-04-24