Incidental Mutation 'R1594:Zfp850'
ID175560
Institutional Source Beutler Lab
Gene Symbol Zfp850
Ensembl Gene ENSMUSG00000096916
Gene Namezinc finger protein 850
SynonymsC130069I09Rik, Gm4636
MMRRC Submission 039631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1594 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27984854-28014115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27989391 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 464 (R464L)
Ref Sequence ENSEMBL: ENSMUSP00000141063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099111] [ENSMUST00000180024] [ENSMUST00000180502]
Predicted Effect probably benign
Transcript: ENSMUST00000099111
Predicted Effect probably benign
Transcript: ENSMUST00000180024
AA Change: R464L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137192
Gene: ENSMUSG00000096916
AA Change: R464L

DomainStartEndE-ValueType
KRAB 14 75 1.56e-34 SMART
ZnF_C2H2 172 194 7.18e1 SMART
ZnF_C2H2 200 222 3.63e-3 SMART
ZnF_C2H2 228 250 8.94e-3 SMART
ZnF_C2H2 256 278 7.49e-5 SMART
ZnF_C2H2 313 335 1.01e-1 SMART
ZnF_C2H2 341 363 4.4e-2 SMART
ZnF_C2H2 369 391 7.37e-4 SMART
ZnF_C2H2 397 419 8.47e-4 SMART
ZnF_C2H2 425 447 1.92e-2 SMART
ZnF_C2H2 453 475 2.99e-4 SMART
ZnF_C2H2 481 503 7.78e-3 SMART
ZnF_C2H2 509 531 1.95e-3 SMART
ZnF_C2H2 537 559 1.92e-2 SMART
ZnF_C2H2 565 587 2.99e-4 SMART
ZnF_C2H2 593 615 1.79e-2 SMART
ZnF_C2H2 621 643 7.37e-4 SMART
ZnF_C2H2 649 671 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180502
AA Change: R464L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000141063
Gene: ENSMUSG00000096916
AA Change: R464L

DomainStartEndE-ValueType
KRAB 14 75 6.5e-37 SMART
ZnF_C2H2 172 194 3e-1 SMART
ZnF_C2H2 200 222 1.5e-5 SMART
ZnF_C2H2 228 250 3.8e-5 SMART
ZnF_C2H2 256 274 2.5e-1 SMART
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 G A 16: 31,127,387 A264V probably benign Het
Adam17 A G 12: 21,340,470 probably null Het
Adcy10 A G 1: 165,525,033 N479D probably benign Het
C2cd2l A G 9: 44,316,773 S84P probably damaging Het
Capn13 A G 17: 73,351,479 V198A probably benign Het
Cblc G A 7: 19,792,546 S206F probably damaging Het
Ccdc7b A T 8: 129,178,357 T159S possibly damaging Het
Clpx A G 9: 65,324,270 T546A probably damaging Het
Col18a1 A G 10: 77,113,036 V214A possibly damaging Het
Csgalnact1 A T 8: 68,358,632 V462E probably damaging Het
Cts6 G A 13: 61,198,367 T202I probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
D630003M21Rik T A 2: 158,211,630 Q646L probably damaging Het
E2f2 A G 4: 136,186,830 Q297R possibly damaging Het
Eef1d T C 15: 75,896,346 E189G probably damaging Het
Fam114a2 A C 11: 57,513,240 probably null Het
Fam24b A C 7: 131,326,296 Y55D probably benign Het
Gimap6 T C 6: 48,702,191 T304A probably benign Het
Gm11232 T C 4: 71,757,335 E63G possibly damaging Het
Hbs1l A G 10: 21,352,023 M152V probably benign Het
Herc3 C A 6: 58,887,584 probably benign Het
Hmx2 A G 7: 131,555,502 D115G probably benign Het
Igsf3 C A 3: 101,451,077 Y761* probably null Het
Kbtbd13 A G 9: 65,391,619 W12R probably benign Het
Kif2c C A 4: 117,178,188 R21L probably benign Het
Kmt2c T C 5: 25,314,878 N2078S probably benign Het
Mgst3 T A 1: 167,373,810 Y102F probably damaging Het
Mov10 G T 3: 104,795,411 T946N probably damaging Het
Nbeal1 T A 1: 60,305,291 I2317N possibly damaging Het
Nid2 T A 14: 19,781,261 I741N probably benign Het
Nlrp9a G A 7: 26,570,507 W786* probably null Het
Olfr44 A C 9: 39,484,746 I166S probably benign Het
Olfr461 T C 6: 40,544,347 I211V probably benign Het
Pi4ka G T 16: 17,373,419 probably benign Het
Plcb4 A G 2: 135,970,390 probably benign Het
Psg16 A G 7: 17,093,823 T144A probably damaging Het
Sec24b A G 3: 129,991,351 V1002A probably benign Het
Shank1 A T 7: 44,327,223 K582* probably null Het
Slc22a7 T C 17: 46,438,031 D120G possibly damaging Het
Slco6c1 T A 1: 97,062,438 T676S probably benign Het
Sulf2 A G 2: 166,084,447 probably benign Het
Tgm1 T C 14: 55,709,519 D344G probably damaging Het
Tle4 C T 19: 14,453,606 W604* probably null Het
Tmco3 T C 8: 13,292,052 S109P probably damaging Het
Unc13d T G 11: 116,068,712 D647A probably benign Het
Usp19 T C 9: 108,498,522 V887A probably damaging Het
Vmn2r49 A T 7: 9,976,623 D727E probably damaging Het
Ypel1 A G 16: 17,082,121 H72R probably damaging Het
Zfp407 A G 18: 84,209,331 V2051A probably benign Het
Zfp438 A G 18: 5,213,515 L481P possibly damaging Het
Zfp985 T C 4: 147,583,080 V135A probably benign Het
Other mutations in Zfp850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02278:Zfp850 APN 7 28008397 missense probably damaging 0.96
R0610:Zfp850 UTSW 7 27989394 missense probably damaging 0.99
R0690:Zfp850 UTSW 7 27985217 missense possibly damaging 0.67
R0711:Zfp850 UTSW 7 27990273 missense probably benign 0.00
R1310:Zfp850 UTSW 7 27989459 missense probably benign 0.40
R1771:Zfp850 UTSW 7 27985275 nonsense probably null
R2189:Zfp850 UTSW 7 27989055 missense probably benign 0.02
R2192:Zfp850 UTSW 7 27985195 missense probably damaging 1.00
R2417:Zfp850 UTSW 7 27989183 missense possibly damaging 0.54
R4321:Zfp850 UTSW 7 27989400 missense probably damaging 0.99
R4770:Zfp850 UTSW 7 27984986 splice site probably null
R4970:Zfp850 UTSW 7 27990233 nonsense probably null
R5112:Zfp850 UTSW 7 27990233 nonsense probably null
R5166:Zfp850 UTSW 7 27990356 nonsense probably null
R5303:Zfp850 UTSW 7 28008413 missense probably damaging 1.00
R5315:Zfp850 UTSW 7 27990318 missense probably benign 0.02
R5496:Zfp850 UTSW 7 28007346 missense probably damaging 0.98
R5547:Zfp850 UTSW 7 27989419 missense probably damaging 1.00
R5677:Zfp850 UTSW 7 27989088 missense probably damaging 1.00
R5927:Zfp850 UTSW 7 27990195 missense probably benign 0.17
R6654:Zfp850 UTSW 7 27985215 nonsense probably null
R6950:Zfp850 UTSW 7 27990514 missense possibly damaging 0.86
R6987:Zfp850 UTSW 7 27990001 missense probably damaging 1.00
R6990:Zfp850 UTSW 7 27990376 missense probably benign 0.09
R7640:Zfp850 UTSW 7 27989209 missense probably benign 0.05
R7856:Zfp850 UTSW 7 27990474 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGACTGAAGTCTGAAGGCTGACC -3'
(R):5'- ACTATATCAGTGCAAGGAATGCGGG -3'

Sequencing Primer
(F):5'- gtgtgaatactccgatgttcag -3'
(R):5'- AGGAATGCGGGAAATTATTTCGTC -3'
Posted On2014-04-24