Incidental Mutation 'R1594:Kbtbd13'
ID175572
Institutional Source Beutler Lab
Gene Symbol Kbtbd13
Ensembl Gene ENSMUSG00000054978
Gene Namekelch repeat and BTB (POZ) domain containing 13
Synonyms
MMRRC Submission 039631-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R1594 (G1)
Quality Score183
Status Validated
Chromosome9
Chromosomal Location65388684-65391652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65391619 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 12 (W12R)
Ref Sequence ENSEMBL: ENSMUSP00000136872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068307]
Predicted Effect probably benign
Transcript: ENSMUST00000068307
AA Change: W12R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136872
Gene: ENSMUSG00000054978
AA Change: W12R

DomainStartEndE-ValueType
Blast:BTB 7 105 9e-57 BLAST
Kelch 210 258 4.33e-4 SMART
Kelch 259 305 2.39e-6 SMART
Blast:Kelch 307 351 5e-6 BLAST
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene belongs to a family of genes encoding proteins containing a BTB domain and several kelch repeats. The BTB domain functions as a protein-protein interaction module, which includes an ability to self-associate or to interact with non-BTB domain-containing proteins. The kelch motif typically occurs in groups of five to seven repeats, and has been found in proteins with diverse functions. Known functions of these family members include transcription regulation, ion channel tetramerization and gating, protein ubiquitination or degradation, and cytoskeleton regulation. The exact function of this family member has yet to be determined. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 G A 16: 31,127,387 A264V probably benign Het
Adam17 A G 12: 21,340,470 probably null Het
Adcy10 A G 1: 165,525,033 N479D probably benign Het
C2cd2l A G 9: 44,316,773 S84P probably damaging Het
Capn13 A G 17: 73,351,479 V198A probably benign Het
Cblc G A 7: 19,792,546 S206F probably damaging Het
Ccdc7b A T 8: 129,178,357 T159S possibly damaging Het
Clpx A G 9: 65,324,270 T546A probably damaging Het
Col18a1 A G 10: 77,113,036 V214A possibly damaging Het
Csgalnact1 A T 8: 68,358,632 V462E probably damaging Het
Cts6 G A 13: 61,198,367 T202I probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
D630003M21Rik T A 2: 158,211,630 Q646L probably damaging Het
E2f2 A G 4: 136,186,830 Q297R possibly damaging Het
Eef1d T C 15: 75,896,346 E189G probably damaging Het
Fam114a2 A C 11: 57,513,240 probably null Het
Fam24b A C 7: 131,326,296 Y55D probably benign Het
Gimap6 T C 6: 48,702,191 T304A probably benign Het
Gm11232 T C 4: 71,757,335 E63G possibly damaging Het
Hbs1l A G 10: 21,352,023 M152V probably benign Het
Herc3 C A 6: 58,887,584 probably benign Het
Hmx2 A G 7: 131,555,502 D115G probably benign Het
Igsf3 C A 3: 101,451,077 Y761* probably null Het
Kif2c C A 4: 117,178,188 R21L probably benign Het
Kmt2c T C 5: 25,314,878 N2078S probably benign Het
Mgst3 T A 1: 167,373,810 Y102F probably damaging Het
Mov10 G T 3: 104,795,411 T946N probably damaging Het
Nbeal1 T A 1: 60,305,291 I2317N possibly damaging Het
Nid2 T A 14: 19,781,261 I741N probably benign Het
Nlrp9a G A 7: 26,570,507 W786* probably null Het
Olfr44 A C 9: 39,484,746 I166S probably benign Het
Olfr461 T C 6: 40,544,347 I211V probably benign Het
Pi4ka G T 16: 17,373,419 probably benign Het
Plcb4 A G 2: 135,970,390 probably benign Het
Psg16 A G 7: 17,093,823 T144A probably damaging Het
Sec24b A G 3: 129,991,351 V1002A probably benign Het
Shank1 A T 7: 44,327,223 K582* probably null Het
Slc22a7 T C 17: 46,438,031 D120G possibly damaging Het
Slco6c1 T A 1: 97,062,438 T676S probably benign Het
Sulf2 A G 2: 166,084,447 probably benign Het
Tgm1 T C 14: 55,709,519 D344G probably damaging Het
Tle4 C T 19: 14,453,606 W604* probably null Het
Tmco3 T C 8: 13,292,052 S109P probably damaging Het
Unc13d T G 11: 116,068,712 D647A probably benign Het
Usp19 T C 9: 108,498,522 V887A probably damaging Het
Vmn2r49 A T 7: 9,976,623 D727E probably damaging Het
Ypel1 A G 16: 17,082,121 H72R probably damaging Het
Zfp407 A G 18: 84,209,331 V2051A probably benign Het
Zfp438 A G 18: 5,213,515 L481P possibly damaging Het
Zfp850 C A 7: 27,989,391 R464L probably benign Het
Zfp985 T C 4: 147,583,080 V135A probably benign Het
Other mutations in Kbtbd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4774:Kbtbd13 UTSW 9 65390743 missense probably benign 0.18
R6392:Kbtbd13 UTSW 9 65390337 missense possibly damaging 0.94
R7556:Kbtbd13 UTSW 9 65391475 missense probably benign 0.00
R7638:Kbtbd13 UTSW 9 65391323 nonsense probably null
R7874:Kbtbd13 UTSW 9 65390302 missense probably benign 0.04
X0061:Kbtbd13 UTSW 9 65390688 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCACAAAAGCGAGCAGTTGTCC -3'
(R):5'- GAATGACCACACAGGTGTCCAGATG -3'

Sequencing Primer
(F):5'- AGCAGTTGTCCGACGTGAC -3'
(R):5'- GAGCAGATCCTATCTTTAGCCAGG -3'
Posted On2014-04-24