Incidental Mutation 'R1594:Hbs1l'
ID175575
Institutional Source Beutler Lab
Gene Symbol Hbs1l
Ensembl Gene ENSMUSG00000019977
Gene NameHbs1-like (S. cerevisiae)
Synonyms2810035F15Rik, eRFS
MMRRC Submission 039631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1594 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location21295979-21368898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21352023 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 152 (M152V)
Ref Sequence ENSEMBL: ENSMUSP00000151897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020153] [ENSMUST00000218714] [ENSMUST00000219915]
Predicted Effect probably benign
Transcript: ENSMUST00000020153
AA Change: M463V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020153
Gene: ENSMUSG00000019977
AA Change: M463V

DomainStartEndE-ValueType
Pfam:HBS1_N 33 125 1e-22 PFAM
low complexity region 142 155 N/A INTRINSIC
Pfam:GTP_EFTU 256 521 1.7e-48 PFAM
Pfam:GTP_EFTU_D3 572 681 9.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218714
AA Change: M152V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219345
Predicted Effect probably benign
Transcript: ENSMUST00000219915
AA Change: M466V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding elongation factor family. It is expressed in multiple tissues with the highest expression in heart and skeletal muscle. The intergenic region of this gene and the MYB gene has been identified to be a quantitative trait locus (QTL) controlling fetal hemoglobin level, and this region influnces erythrocyte, platelet, and monocyte counts as well as erythrocyte volume and hemoglobin content. DNA polymorphisms at this region associate with fetal hemoglobin levels and pain crises in sickle cell disease. A single nucleotide polymorphism in exon 1 of this gene is significantly associated with severity in beta-thalassemia/Hemoglobin E. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 G A 16: 31,127,387 A264V probably benign Het
Adam17 A G 12: 21,340,470 probably null Het
Adcy10 A G 1: 165,525,033 N479D probably benign Het
C2cd2l A G 9: 44,316,773 S84P probably damaging Het
Capn13 A G 17: 73,351,479 V198A probably benign Het
Cblc G A 7: 19,792,546 S206F probably damaging Het
Ccdc7b A T 8: 129,178,357 T159S possibly damaging Het
Clpx A G 9: 65,324,270 T546A probably damaging Het
Col18a1 A G 10: 77,113,036 V214A possibly damaging Het
Csgalnact1 A T 8: 68,358,632 V462E probably damaging Het
Cts6 G A 13: 61,198,367 T202I probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
D630003M21Rik T A 2: 158,211,630 Q646L probably damaging Het
E2f2 A G 4: 136,186,830 Q297R possibly damaging Het
Eef1d T C 15: 75,896,346 E189G probably damaging Het
Fam114a2 A C 11: 57,513,240 probably null Het
Fam24b A C 7: 131,326,296 Y55D probably benign Het
Gimap6 T C 6: 48,702,191 T304A probably benign Het
Gm11232 T C 4: 71,757,335 E63G possibly damaging Het
Herc3 C A 6: 58,887,584 probably benign Het
Hmx2 A G 7: 131,555,502 D115G probably benign Het
Igsf3 C A 3: 101,451,077 Y761* probably null Het
Kbtbd13 A G 9: 65,391,619 W12R probably benign Het
Kif2c C A 4: 117,178,188 R21L probably benign Het
Kmt2c T C 5: 25,314,878 N2078S probably benign Het
Mgst3 T A 1: 167,373,810 Y102F probably damaging Het
Mov10 G T 3: 104,795,411 T946N probably damaging Het
Nbeal1 T A 1: 60,305,291 I2317N possibly damaging Het
Nid2 T A 14: 19,781,261 I741N probably benign Het
Nlrp9a G A 7: 26,570,507 W786* probably null Het
Olfr44 A C 9: 39,484,746 I166S probably benign Het
Olfr461 T C 6: 40,544,347 I211V probably benign Het
Pi4ka G T 16: 17,373,419 probably benign Het
Plcb4 A G 2: 135,970,390 probably benign Het
Psg16 A G 7: 17,093,823 T144A probably damaging Het
Sec24b A G 3: 129,991,351 V1002A probably benign Het
Shank1 A T 7: 44,327,223 K582* probably null Het
Slc22a7 T C 17: 46,438,031 D120G possibly damaging Het
Slco6c1 T A 1: 97,062,438 T676S probably benign Het
Sulf2 A G 2: 166,084,447 probably benign Het
Tgm1 T C 14: 55,709,519 D344G probably damaging Het
Tle4 C T 19: 14,453,606 W604* probably null Het
Tmco3 T C 8: 13,292,052 S109P probably damaging Het
Unc13d T G 11: 116,068,712 D647A probably benign Het
Usp19 T C 9: 108,498,522 V887A probably damaging Het
Vmn2r49 A T 7: 9,976,623 D727E probably damaging Het
Ypel1 A G 16: 17,082,121 H72R probably damaging Het
Zfp407 A G 18: 84,209,331 V2051A probably benign Het
Zfp438 A G 18: 5,213,515 L481P possibly damaging Het
Zfp850 C A 7: 27,989,391 R464L probably benign Het
Zfp985 T C 4: 147,583,080 V135A probably benign Het
Other mutations in Hbs1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Hbs1l APN 10 21307756 missense probably benign 0.03
IGL02948:Hbs1l APN 10 21341711 splice site probably benign
R0375:Hbs1l UTSW 10 21342541 missense possibly damaging 0.76
R0465:Hbs1l UTSW 10 21352041 missense probably null 0.85
R0555:Hbs1l UTSW 10 21349323 missense probably benign 0.14
R0909:Hbs1l UTSW 10 21307738 missense probably benign 0.00
R1172:Hbs1l UTSW 10 21304638 missense probably damaging 1.00
R1612:Hbs1l UTSW 10 21358835 missense probably damaging 1.00
R1869:Hbs1l UTSW 10 21358406 splice site probably null
R2109:Hbs1l UTSW 10 21341932 nonsense probably null
R2369:Hbs1l UTSW 10 21307745 missense probably benign 0.01
R2404:Hbs1l UTSW 10 21296047 start gained probably benign
R4077:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4079:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4534:Hbs1l UTSW 10 21341915 missense possibly damaging 0.74
R4796:Hbs1l UTSW 10 21342506 missense probably damaging 1.00
R4852:Hbs1l UTSW 10 21358388 missense possibly damaging 0.92
R5069:Hbs1l UTSW 10 21354647 missense probably damaging 1.00
R5946:Hbs1l UTSW 10 21341756 missense probably benign
R6232:Hbs1l UTSW 10 21307758 splice site probably null
R6264:Hbs1l UTSW 10 21367757 missense possibly damaging 0.92
R6542:Hbs1l UTSW 10 21304617 missense probably benign 0.11
R6831:Hbs1l UTSW 10 21341868 missense probably benign 0.29
R7295:Hbs1l UTSW 10 21310152 missense probably benign 0.12
R7470:Hbs1l UTSW 10 21358784 missense possibly damaging 0.96
R7652:Hbs1l UTSW 10 21364760 missense probably benign 0.02
R7695:Hbs1l UTSW 10 21299217 missense possibly damaging 0.49
R7909:Hbs1l UTSW 10 21358404 critical splice donor site probably null
R8325:Hbs1l UTSW 10 21307649 missense probably benign 0.02
R8353:Hbs1l UTSW 10 21309279 missense probably benign
R8453:Hbs1l UTSW 10 21309279 missense probably benign
R8878:Hbs1l UTSW 10 21358812 missense possibly damaging 0.47
R8880:Hbs1l UTSW 10 21309969 missense probably damaging 0.99
R8933:Hbs1l UTSW 10 21367685 nonsense probably null
X0018:Hbs1l UTSW 10 21351987 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGTATGCCTCCATGAGCAAG -3'
(R):5'- GACAGGTAGGGCAAGTTCTAAACTCAC -3'

Sequencing Primer
(F):5'- AAGTTGAACTGCCCTGAGTC -3'
(R):5'- GGGCAAGTTCTAAACTCACTAATCTG -3'
Posted On2014-04-24