Incidental Mutation 'R1594:Tgm1'
ID175583
Institutional Source Beutler Lab
Gene Symbol Tgm1
Ensembl Gene ENSMUSG00000022218
Gene Nametransglutaminase 1, K polypeptide
SynonymsTG K, TGase 1, protein-glutamine-gamma-glutamyltransferase, K polypeptide, 2310004J08Rik
MMRRC Submission 039631-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R1594 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55700009-55713926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55709519 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 344 (D344G)
Ref Sequence ENSEMBL: ENSMUSP00000137642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002389] [ENSMUST00000168729] [ENSMUST00000178034] [ENSMUST00000226907] [ENSMUST00000227958] [ENSMUST00000228123]
Predicted Effect probably damaging
Transcript: ENSMUST00000002389
AA Change: D344G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000002389
Gene: ENSMUSG00000022218
AA Change: D344G

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168729
AA Change: D344G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128090
Gene: ENSMUSG00000022218
AA Change: D344G

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 109 228 5.5e-35 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 1.5e-22 PFAM
Pfam:Transglut_C 690 787 1e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178034
AA Change: D344G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137642
Gene: ENSMUSG00000022218
AA Change: D344G

DomainStartEndE-ValueType
low complexity region 13 45 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
low complexity region 65 95 N/A INTRINSIC
Pfam:Transglut_N 110 226 1.2e-32 PFAM
TGc 368 461 1.7e-43 SMART
low complexity region 550 561 N/A INTRINSIC
Pfam:Transglut_C 578 682 3.6e-24 PFAM
Pfam:Transglut_C 690 787 1.3e-20 PFAM
low complexity region 788 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227106
Predicted Effect probably benign
Transcript: ENSMUST00000227958
Predicted Effect probably benign
Transcript: ENSMUST00000228123
Meta Mutation Damage Score 0.3985 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that catalyzes the addition of an alkyl group from an akylamine to a glutamine residue of a protein, forming an alkylglutamine in the protein. This protein alkylation leads to crosslinking of proteins and catenation of polyamines to proteins. This gene contains either one or two copies of a 22 nt repeat unit in its 3' UTR. Mutations in this gene have been associated with autosomal recessive lamellar ichthyosis (LI) and nonbullous congenital ichthyosiform erythroderma (NCIE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele are small and hypoactive and die within hours of birth displaying failure to suckle, progressive dehydration, and epidermal defects including a reddish, tight and wrinkled skin, hyperkeratosis, and impaired skin barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 G A 16: 31,127,387 A264V probably benign Het
Adam17 A G 12: 21,340,470 probably null Het
Adcy10 A G 1: 165,525,033 N479D probably benign Het
C2cd2l A G 9: 44,316,773 S84P probably damaging Het
Capn13 A G 17: 73,351,479 V198A probably benign Het
Cblc G A 7: 19,792,546 S206F probably damaging Het
Ccdc7b A T 8: 129,178,357 T159S possibly damaging Het
Clpx A G 9: 65,324,270 T546A probably damaging Het
Col18a1 A G 10: 77,113,036 V214A possibly damaging Het
Csgalnact1 A T 8: 68,358,632 V462E probably damaging Het
Cts6 G A 13: 61,198,367 T202I probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
D630003M21Rik T A 2: 158,211,630 Q646L probably damaging Het
E2f2 A G 4: 136,186,830 Q297R possibly damaging Het
Eef1d T C 15: 75,896,346 E189G probably damaging Het
Fam114a2 A C 11: 57,513,240 probably null Het
Fam24b A C 7: 131,326,296 Y55D probably benign Het
Gimap6 T C 6: 48,702,191 T304A probably benign Het
Gm11232 T C 4: 71,757,335 E63G possibly damaging Het
Hbs1l A G 10: 21,352,023 M152V probably benign Het
Herc3 C A 6: 58,887,584 probably benign Het
Hmx2 A G 7: 131,555,502 D115G probably benign Het
Igsf3 C A 3: 101,451,077 Y761* probably null Het
Kbtbd13 A G 9: 65,391,619 W12R probably benign Het
Kif2c C A 4: 117,178,188 R21L probably benign Het
Kmt2c T C 5: 25,314,878 N2078S probably benign Het
Mgst3 T A 1: 167,373,810 Y102F probably damaging Het
Mov10 G T 3: 104,795,411 T946N probably damaging Het
Nbeal1 T A 1: 60,305,291 I2317N possibly damaging Het
Nid2 T A 14: 19,781,261 I741N probably benign Het
Nlrp9a G A 7: 26,570,507 W786* probably null Het
Olfr44 A C 9: 39,484,746 I166S probably benign Het
Olfr461 T C 6: 40,544,347 I211V probably benign Het
Pi4ka G T 16: 17,373,419 probably benign Het
Plcb4 A G 2: 135,970,390 probably benign Het
Psg16 A G 7: 17,093,823 T144A probably damaging Het
Sec24b A G 3: 129,991,351 V1002A probably benign Het
Shank1 A T 7: 44,327,223 K582* probably null Het
Slc22a7 T C 17: 46,438,031 D120G possibly damaging Het
Slco6c1 T A 1: 97,062,438 T676S probably benign Het
Sulf2 A G 2: 166,084,447 probably benign Het
Tle4 C T 19: 14,453,606 W604* probably null Het
Tmco3 T C 8: 13,292,052 S109P probably damaging Het
Unc13d T G 11: 116,068,712 D647A probably benign Het
Usp19 T C 9: 108,498,522 V887A probably damaging Het
Vmn2r49 A T 7: 9,976,623 D727E probably damaging Het
Ypel1 A G 16: 17,082,121 H72R probably damaging Het
Zfp407 A G 18: 84,209,331 V2051A probably benign Het
Zfp438 A G 18: 5,213,515 L481P possibly damaging Het
Zfp850 C A 7: 27,989,391 R464L probably benign Het
Zfp985 T C 4: 147,583,080 V135A probably benign Het
Other mutations in Tgm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Tgm1 APN 14 55704935 missense possibly damaging 0.92
IGL02934:Tgm1 APN 14 55709989 missense probably damaging 1.00
IGL03243:Tgm1 APN 14 55705907 missense probably damaging 0.98
IGL03282:Tgm1 APN 14 55711070 missense probably damaging 1.00
PIT4458001:Tgm1 UTSW 14 55712565 missense unknown
R0277:Tgm1 UTSW 14 55710927 unclassified probably benign
R0277:Tgm1 UTSW 14 55712652 unclassified probably benign
R0478:Tgm1 UTSW 14 55700334 nonsense probably null
R1349:Tgm1 UTSW 14 55711201 unclassified probably benign
R1776:Tgm1 UTSW 14 55709397 missense probably damaging 0.99
R1852:Tgm1 UTSW 14 55704941 missense probably damaging 1.00
R1988:Tgm1 UTSW 14 55705577 missense probably benign 0.00
R2064:Tgm1 UTSW 14 55709471 missense probably damaging 1.00
R2139:Tgm1 UTSW 14 55709543 missense probably damaging 1.00
R2427:Tgm1 UTSW 14 55712100 critical splice donor site probably null
R3710:Tgm1 UTSW 14 55712595 unclassified probably benign
R3917:Tgm1 UTSW 14 55712757 splice site probably benign
R4697:Tgm1 UTSW 14 55705681 missense probably benign 0.05
R4804:Tgm1 UTSW 14 55705619 missense probably benign 0.38
R5074:Tgm1 UTSW 14 55709935 missense probably damaging 1.00
R5341:Tgm1 UTSW 14 55700248 missense possibly damaging 0.90
R5346:Tgm1 UTSW 14 55711172 missense probably damaging 0.99
R5557:Tgm1 UTSW 14 55705643 missense probably benign 0.10
R5566:Tgm1 UTSW 14 55712436 missense probably damaging 0.99
R5828:Tgm1 UTSW 14 55705554 missense probably benign 0.38
R6802:Tgm1 UTSW 14 55712482 unclassified probably benign
R7017:Tgm1 UTSW 14 55704941 missense possibly damaging 0.76
R7094:Tgm1 UTSW 14 55704843 missense possibly damaging 0.53
R7549:Tgm1 UTSW 14 55705903 missense probably benign 0.02
R7731:Tgm1 UTSW 14 55710521 missense probably benign 0.21
R7799:Tgm1 UTSW 14 55712475 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGCAGAAATAGAACCCTTCCCTC -3'
(R):5'- GCACACCCAGTGTTCACATTCCAG -3'

Sequencing Primer
(F):5'- CCTCATAGAGCCCAGGCTATTC -3'
(R):5'- CATTCCAGTGTTACAGCAGATGG -3'
Posted On2014-04-24