Incidental Mutation 'R1594:Tle4'
ID175592
Institutional Source Beutler Lab
Gene Symbol Tle4
Ensembl Gene ENSMUSG00000024642
Gene Nametransducin-like enhancer of split 4
SynonymsBce1, ESTM14, 5730411M05Rik, Grg4, ESTM13
MMRRC Submission 039631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1594 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location14448072-14598051 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 14453606 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 604 (W604*)
Ref Sequence ENSEMBL: ENSMUSP00000126249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052011] [ENSMUST00000167776]
Predicted Effect probably null
Transcript: ENSMUST00000052011
AA Change: W604*
SMART Domains Protein: ENSMUSP00000057527
Gene: ENSMUSG00000024642
AA Change: W604*

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 9.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167776
AA Change: W604*
SMART Domains Protein: ENSMUSP00000126249
Gene: ENSMUSG00000024642
AA Change: W604*

DomainStartEndE-ValueType
Pfam:TLE_N 8 138 5.1e-76 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 199 216 N/A INTRINSIC
low complexity region 226 238 N/A INTRINSIC
low complexity region 289 316 N/A INTRINSIC
WD40 477 514 4.18e-2 SMART
WD40 520 561 3.64e-2 SMART
WD40 566 605 9.38e-5 SMART
WD40 608 647 1.14e-8 SMART
WD40 650 688 2.29e1 SMART
WD40 690 729 7.39e-3 SMART
WD40 730 770 4.14e-1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are runted and die around 4 weeks of age with leukocytopenia, B cell lymphopenia, reduced bone mineralization and reduced hematopoietic stem cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 G A 16: 31,127,387 A264V probably benign Het
Adam17 A G 12: 21,340,470 probably null Het
Adcy10 A G 1: 165,525,033 N479D probably benign Het
C2cd2l A G 9: 44,316,773 S84P probably damaging Het
Capn13 A G 17: 73,351,479 V198A probably benign Het
Cblc G A 7: 19,792,546 S206F probably damaging Het
Ccdc7b A T 8: 129,178,357 T159S possibly damaging Het
Clpx A G 9: 65,324,270 T546A probably damaging Het
Col18a1 A G 10: 77,113,036 V214A possibly damaging Het
Csgalnact1 A T 8: 68,358,632 V462E probably damaging Het
Cts6 G A 13: 61,198,367 T202I probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
D630003M21Rik T A 2: 158,211,630 Q646L probably damaging Het
E2f2 A G 4: 136,186,830 Q297R possibly damaging Het
Eef1d T C 15: 75,896,346 E189G probably damaging Het
Fam114a2 A C 11: 57,513,240 probably null Het
Fam24b A C 7: 131,326,296 Y55D probably benign Het
Gimap6 T C 6: 48,702,191 T304A probably benign Het
Gm11232 T C 4: 71,757,335 E63G possibly damaging Het
Hbs1l A G 10: 21,352,023 M152V probably benign Het
Herc3 C A 6: 58,887,584 probably benign Het
Hmx2 A G 7: 131,555,502 D115G probably benign Het
Igsf3 C A 3: 101,451,077 Y761* probably null Het
Kbtbd13 A G 9: 65,391,619 W12R probably benign Het
Kif2c C A 4: 117,178,188 R21L probably benign Het
Kmt2c T C 5: 25,314,878 N2078S probably benign Het
Mgst3 T A 1: 167,373,810 Y102F probably damaging Het
Mov10 G T 3: 104,795,411 T946N probably damaging Het
Nbeal1 T A 1: 60,305,291 I2317N possibly damaging Het
Nid2 T A 14: 19,781,261 I741N probably benign Het
Nlrp9a G A 7: 26,570,507 W786* probably null Het
Olfr44 A C 9: 39,484,746 I166S probably benign Het
Olfr461 T C 6: 40,544,347 I211V probably benign Het
Pi4ka G T 16: 17,373,419 probably benign Het
Plcb4 A G 2: 135,970,390 probably benign Het
Psg16 A G 7: 17,093,823 T144A probably damaging Het
Sec24b A G 3: 129,991,351 V1002A probably benign Het
Shank1 A T 7: 44,327,223 K582* probably null Het
Slc22a7 T C 17: 46,438,031 D120G possibly damaging Het
Slco6c1 T A 1: 97,062,438 T676S probably benign Het
Sulf2 A G 2: 166,084,447 probably benign Het
Tgm1 T C 14: 55,709,519 D344G probably damaging Het
Tmco3 T C 8: 13,292,052 S109P probably damaging Het
Unc13d T G 11: 116,068,712 D647A probably benign Het
Usp19 T C 9: 108,498,522 V887A probably damaging Het
Vmn2r49 A T 7: 9,976,623 D727E probably damaging Het
Ypel1 A G 16: 17,082,121 H72R probably damaging Het
Zfp407 A G 18: 84,209,331 V2051A probably benign Het
Zfp438 A G 18: 5,213,515 L481P possibly damaging Het
Zfp850 C A 7: 27,989,391 R464L probably benign Het
Zfp985 T C 4: 147,583,080 V135A probably benign Het
Other mutations in Tle4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Tle4 APN 19 14468261 missense probably benign 0.00
IGL01449:Tle4 APN 19 14465340 missense probably benign 0.00
IGL01618:Tle4 APN 19 14544814 missense probably benign 0.07
IGL01636:Tle4 APN 19 14452533 missense probably damaging 0.97
IGL01750:Tle4 APN 19 14449789 missense probably damaging 1.00
IGL02376:Tle4 APN 19 14594404 missense probably damaging 1.00
R0006:Tle4 UTSW 19 14466714 splice site probably benign
R1068:Tle4 UTSW 19 14452179 missense probably damaging 1.00
R1174:Tle4 UTSW 19 14468262 missense probably benign
R1671:Tle4 UTSW 19 14453739 missense probably damaging 1.00
R1891:Tle4 UTSW 19 14544786 critical splice donor site probably null
R1951:Tle4 UTSW 19 14516357 critical splice donor site probably null
R2068:Tle4 UTSW 19 14449749 nonsense probably null
R3858:Tle4 UTSW 19 14468213 missense probably benign 0.11
R3859:Tle4 UTSW 19 14468213 missense probably benign 0.11
R3946:Tle4 UTSW 19 14597388 missense probably damaging 0.98
R4357:Tle4 UTSW 19 14468261 missense probably benign 0.00
R4395:Tle4 UTSW 19 14517938 missense probably benign 0.20
R4491:Tle4 UTSW 19 14454865 missense probably damaging 1.00
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R4860:Tle4 UTSW 19 14464345 missense probably benign 0.30
R5336:Tle4 UTSW 19 14454739 critical splice donor site probably null
R5516:Tle4 UTSW 19 14454889 missense probably damaging 0.99
R5611:Tle4 UTSW 19 14449795 missense probably damaging 1.00
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6032:Tle4 UTSW 19 14452108 missense possibly damaging 0.74
R6113:Tle4 UTSW 19 14595588 critical splice donor site probably null
R6513:Tle4 UTSW 19 14451692 missense probably damaging 0.99
R6995:Tle4 UTSW 19 14564453 critical splice acceptor site probably null
R7175:Tle4 UTSW 19 14451707 missense probably damaging 1.00
R7310:Tle4 UTSW 19 14517791 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAACCACTGCTGAAGTGTGCC -3'
(R):5'- CACCTTAATTGTTGGAGGGGAAGCC -3'

Sequencing Primer
(F):5'- GCTTCTCACTGATGAGCTAGG -3'
(R):5'- CAGCACACTGTCCATCTGG -3'
Posted On2014-04-24