Mutagenetix > Incidental Mutations

Incidental Mutation 'R1593:Tpp2'

175594

Institutional Source

Beutler Lab

Gene Symbol

Tpp2

Ensembl Gene

ENSMUSG00000041763

Gene Name

tripeptidyl peptidase II

Synonyms

TppII

MMRRC Submission

039630-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.630) question?

Stock #

R1593 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43933647-44003000 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43975433 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 644 (H644R)

Ref Sequence

ENSEMBL: ENSMUSP00000139918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388]

Predicted Effect

probably benign
Transcript: ENSMUST00000087933
AA Change: H644R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: H644R

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	35	500	1.4e-96	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	777	964	2.4e-80	PFAM
low complexity region	1017	1033	N/A	INTRINSIC
PDB:3LXU\|X	1034	1262	1e-20	PDB

Predicted Effect

unknown
Transcript: ENSMUST00000186441
AA Change: H152R

Predicted Effect

probably benign
Transcript: ENSMUST00000188302

SMART Domains

Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	4.3e-84	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000188313
AA Change: H644R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: H644R

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	5.1e-83	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	966	2.7e-93	PFAM
low complexity region	1004	1020	N/A	INTRINSIC
PDB:3LXU\|X	1021	1249	1e-20	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000189388
AA Change: H644R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: H644R

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	2.3e-81	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	880	7.8e-49	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	A	T	11: 100,481,755	I902N	possibly damaging	Het
Acsl6	A	G	11: 54,323,308	D88G	probably damaging	Het
Adam1a	A	C	5: 121,519,643	I529S	probably benign	Het
Ap3b1	T	C	13: 94,501,927	V838A	unknown	Het
Arrdc2	T	C	8: 70,837,120	Y280C	probably damaging	Het
Atg10	T	C	13: 91,154,261	T53A	probably benign	Het
Ccdc136	T	C	6: 29,415,584	S699P	probably damaging	Het
Cdc23	C	A	18: 34,636,326	V462L	possibly damaging	Het
Clcn6	C	T	4: 148,014,594	A431T	probably benign	Het
Cntn6	T	G	6: 104,832,580	H525Q	possibly damaging	Het
Ctr9	T	C	7: 111,042,853	F296S	possibly damaging	Het
Ctsq	T	A	13: 61,036,172		probably null	Het
Ehd1	A	G	19: 6,298,300	D436G	probably benign	Het
Epha6	A	T	16: 60,424,904	F311I	probably damaging	Het
Esrrg	A	T	1: 188,066,385	T150S	possibly damaging	Het
Exoc2	C	A	13: 30,856,761	R758L	possibly damaging	Het
Exosc7	G	C	9: 123,131,993	V242L	probably benign	Het
Fcho2	T	C	13: 98,784,807	D190G	possibly damaging	Het
Fgd6	T	C	10: 94,045,032	S583P	probably damaging	Het
Frmd4a	A	G	2: 4,473,188	Y60C	probably damaging	Het
Gldc	A	T	19: 30,113,750	I815N	probably damaging	Het
Grm2	A	T	9: 106,650,914	L257Q	probably damaging	Het
Hectd3	C	A	4: 116,997,020	T289K	possibly damaging	Het
Itgb4	T	C	11: 115,980,991	V207A	probably damaging	Het
Lamb3	A	G	1: 193,330,796	E443G	probably damaging	Het
Meis2	T	A	2: 116,000,264	D256V	probably damaging	Het
Muc4	A	G	16: 32,754,686	N1520S	probably benign	Het
Nckap1l	A	G	15: 103,478,854	R719G	probably null	Het
Olfr800	A	T	10: 129,660,225	R140*	probably null	Het
Pabpc6	A	T	17: 9,667,813	M603K	probably damaging	Het
Pcnx2	C	A	8: 125,759,273	R1862L	probably benign	Het
Pon2	T	C	6: 5,273,003	D122G	probably benign	Het
Ppig	T	A	2: 69,749,081	W378R	unknown	Het
Ralgapa1	T	A	12: 55,770,703	E389D	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rarg	A	G	15: 102,239,941	F233L	probably damaging	Het
Rasgrp2	T	C	19: 6,403,460	F90L	possibly damaging	Het
Rrp12	T	A	19: 41,863,241	H1285L	probably benign	Het
Slc16a13	C	A	11: 70,219,082	A198S	probably benign	Het
Spag9	A	G	11: 94,097,233	D441G	probably damaging	Het
Stxbp5l	A	G	16: 37,116,052	F1099S	probably damaging	Het
Tex19.1	T	A	11: 121,147,253	W146R	probably damaging	Het
Tmem8	T	A	17: 26,118,407	I399N	possibly damaging	Het
Tmod3	T	C	9: 75,511,163	D197G	probably benign	Het
Trpm2	A	G	10: 77,943,076	V352A	possibly damaging	Het
Tulp1	T	C	17: 28,362,701	K233E	probably damaging	Het
Vsir	A	G	10: 60,357,958	T67A	possibly damaging	Het
Wdr49	T	C	3: 75,396,941	N487S	probably benign	Het
Zbtb20	A	G	16: 43,609,423	N99S	probably damaging	Het
Zfp583	C	T	7: 6,317,009	G335S	probably benign	Het
Zgrf1	T	A	3: 127,561,026	V98E	possibly damaging	Het

Other mutations in Tpp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Tpp2	APN	1	43983291	missense	possibly damaging	0.90
IGL01021:Tpp2	APN	1	43934187	nonsense	probably null
IGL01096:Tpp2	APN	1	43960888	missense	probably damaging	1.00
IGL01344:Tpp2	APN	1	43983262	missense	probably benign	0.04
IGL01642:Tpp2	APN	1	43954653	missense	probably damaging	1.00
IGL02719:Tpp2	APN	1	43940231	missense	probably benign	0.09
IGL02890:Tpp2	APN	1	43999690	missense	probably damaging	1.00
IGL03102:Tpp2	APN	1	43956489	missense	probably damaging	1.00
IGL03175:Tpp2	APN	1	43973511	missense	probably benign	0.35
beaver	UTSW	1	43971715	missense	probably benign	0.08
billingsly	UTSW	1	43983552	missense	probably damaging	1.00
cleaver	UTSW	1	43978508	nonsense	probably null
Eddie	UTSW	1	43968988	missense	probably damaging	1.00
June	UTSW	1	43954710	missense	probably damaging	1.00
state	UTSW	1	43978438	missense	possibly damaging	0.48
wally	UTSW	1	43992396	critical splice donor site	probably null
Ward	UTSW	1	43954736	missense	possibly damaging	0.82
BB010:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
BB020:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R0001:Tpp2	UTSW	1	43971726	missense	probably benign	0.00
R0003:Tpp2	UTSW	1	43960139	missense	possibly damaging	0.94
R0066:Tpp2	UTSW	1	43981748	missense	possibly damaging	0.56
R0110:Tpp2	UTSW	1	43999693	missense	probably damaging	1.00
R0110:Tpp2	UTSW	1	43978504	missense	probably benign	0.00
R0167:Tpp2	UTSW	1	43970488	missense	probably benign	0.01
R0441:Tpp2	UTSW	1	43990562	missense	possibly damaging	0.85
R0520:Tpp2	UTSW	1	43990530	missense	probably damaging	1.00
R0639:Tpp2	UTSW	1	43975447	missense	probably benign	0.00
R1118:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1119:Tpp2	UTSW	1	43992396	critical splice donor site	probably null
R1702:Tpp2	UTSW	1	43990548	missense	probably damaging	0.99
R1756:Tpp2	UTSW	1	43978725	splice site	probably null
R2066:Tpp2	UTSW	1	43978438	missense	possibly damaging	0.48
R2171:Tpp2	UTSW	1	43957446	missense	probably benign	0.00
R2378:Tpp2	UTSW	1	43999765	missense	probably damaging	0.99
R2394:Tpp2	UTSW	1	43983186	missense	possibly damaging	0.83
R2507:Tpp2	UTSW	1	44001449	missense	probably benign	0.31
R2879:Tpp2	UTSW	1	43971623	missense	probably damaging	1.00
R3436:Tpp2	UTSW	1	43940144	missense	probably damaging	0.99
R4106:Tpp2	UTSW	1	44001457	missense	possibly damaging	0.71
R4658:Tpp2	UTSW	1	43954710	missense	probably damaging	1.00
R4760:Tpp2	UTSW	1	43971715	missense	probably benign	0.08
R4963:Tpp2	UTSW	1	43992268	missense	probably damaging	1.00
R5049:Tpp2	UTSW	1	44001473	missense	possibly damaging	0.46
R5073:Tpp2	UTSW	1	43954736	missense	possibly damaging	0.82
R6010:Tpp2	UTSW	1	43951213	critical splice donor site	probably null
R6118:Tpp2	UTSW	1	43940146	missense	probably damaging	1.00
R6155:Tpp2	UTSW	1	43956489	missense	probably damaging	1.00
R6169:Tpp2	UTSW	1	43983579	missense	probably damaging	0.99
R6236:Tpp2	UTSW	1	43977317	missense	probably benign	0.01
R6695:Tpp2	UTSW	1	43983276	missense	probably benign
R6845:Tpp2	UTSW	1	43978508	nonsense	probably null
R7054:Tpp2	UTSW	1	43983158	missense	probably damaging	1.00
R7094:Tpp2	UTSW	1	43968988	missense	probably damaging	1.00
R7223:Tpp2	UTSW	1	43968888	missense	probably damaging	1.00
R7316:Tpp2	UTSW	1	43970431	missense	probably benign	0.00
R7324:Tpp2	UTSW	1	43978778	missense	probably damaging	1.00
R7363:Tpp2	UTSW	1	43985422	missense	probably benign	0.00
R7454:Tpp2	UTSW	1	43954659	missense	probably benign	0.01
R7496:Tpp2	UTSW	1	43983517	missense	probably benign	0.09
R7699:Tpp2	UTSW	1	43970466	missense	probably benign
R7700:Tpp2	UTSW	1	43970466	missense	probably benign
R7804:Tpp2	UTSW	1	43983281	missense	probably benign	0.00
R7933:Tpp2	UTSW	1	43960961	missense	probably damaging	1.00
R7979:Tpp2	UTSW	1	43940137	missense	probably benign	0.35
R8032:Tpp2	UTSW	1	43975468	missense	possibly damaging	0.82
R8101:Tpp2	UTSW	1	43970440	missense	probably damaging	1.00
R8245:Tpp2	UTSW	1	43983552	missense	probably damaging	1.00
R8314:Tpp2	UTSW	1	43934227	missense	probably benign	0.10
R8518:Tpp2	UTSW	1	43980385	missense	probably damaging	1.00
R8519:Tpp2	UTSW	1	43977205	critical splice acceptor site	probably null
R8529:Tpp2	UTSW	1	43983140	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCATCTGTGTGCTGCTGTCAGAG -3'
(R):5'- TCTATACCGGAGCCCAGACTCATTC -3'

Sequencing Primer
(F):5'- CTGCTGTCAGAGGTTATATCTACTGC -3'
(R):5'- CAGACTCATTCCCTAAAGTGGTG -3'

Posted On

2014-04-24