Incidental Mutation 'R1593:Esrrg'
ID175595
Institutional Source Beutler Lab
Gene Symbol Esrrg
Ensembl Gene ENSMUSG00000026610
Gene Nameestrogen-related receptor gamma
SynonymsERR3, estrogen-related receptor 3, NR3B3, Errg
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1593 (G1)
Quality Score207
Status Not validated
Chromosome1
Chromosomal Location187608791-188214885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 188066385 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 150 (T150S)
Ref Sequence ENSEMBL: ENSMUSP00000106564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027906
AA Change: T173S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: T173S

DomainStartEndE-ValueType
low complexity region 57 70 N/A INTRINSIC
ZnF_C4 125 196 4.04e-40 SMART
Blast:HOLI 203 233 5e-6 BLAST
HOLI 270 428 1.64e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110938
AA Change: T150S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610
AA Change: T150S

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110939
AA Change: T150S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610
AA Change: T150S

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Esrrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Esrrg APN 1 188210910 missense probably damaging 1.00
IGL01635:Esrrg APN 1 188198600 missense probably damaging 1.00
IGL01642:Esrrg APN 1 188210915 missense probably benign 0.01
IGL02740:Esrrg APN 1 188198741 missense probably benign 0.04
IGL03126:Esrrg APN 1 187997987 intron probably benign
IGL03391:Esrrg APN 1 188150223 missense possibly damaging 0.70
R0395:Esrrg UTSW 1 188198635 missense probably damaging 1.00
R0645:Esrrg UTSW 1 188043341 missense probably benign 0.00
R1700:Esrrg UTSW 1 188043653 missense probably damaging 1.00
R1855:Esrrg UTSW 1 188211098 missense probably damaging 1.00
R3552:Esrrg UTSW 1 188150190 missense probably benign 0.05
R3605:Esrrg UTSW 1 188211102 missense possibly damaging 0.74
R4384:Esrrg UTSW 1 188043711 missense probably damaging 1.00
R5255:Esrrg UTSW 1 188146358 missense probably damaging 1.00
R5443:Esrrg UTSW 1 188043425 missense possibly damaging 0.78
R5511:Esrrg UTSW 1 188211107 missense probably damaging 1.00
R5516:Esrrg UTSW 1 188198730 missense possibly damaging 0.56
R5543:Esrrg UTSW 1 188150254 missense probably damaging 0.96
R5686:Esrrg UTSW 1 188150198 missense probably benign 0.24
R5990:Esrrg UTSW 1 188198798 missense probably damaging 1.00
R6030:Esrrg UTSW 1 188198707 missense probably benign 0.04
R6030:Esrrg UTSW 1 188198707 missense probably benign 0.04
R7058:Esrrg UTSW 1 188150306 missense probably damaging 1.00
R7487:Esrrg UTSW 1 188146423 missense probably benign 0.03
Z1088:Esrrg UTSW 1 188150218 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGACACTTGTCACATGTCTGGTCAC -3'
(R):5'- TGGCGTACTTGACACAGAACACAC -3'

Sequencing Primer
(F):5'- CACATGTCTGGTCACATGTTTTTG -3'
(R):5'- GTGGGGAATTTGATTCACATCACAG -3'
Posted On2014-04-24