Mutagenetix > Incidental Mutations

Incidental Mutation 'R1593:Meis2'

175599

Institutional Source

Beutler Lab

Gene Symbol

Meis2

Ensembl Gene

ENSMUSG00000027210

Gene Name

Meis homeobox 2

Synonyms

Stra10, Meis2, A430109D20Rik, Mrg1

MMRRC Submission

039630-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.879) question?

Stock #

R1593 (G1)

Quality Score

208

Status

Not validated

Chromosome

Chromosomal Location

115863064-116065839 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116000264 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 256 (D256V)

Ref Sequence

ENSEMBL: ENSMUSP00000106532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028639] [ENSMUST00000074285] [ENSMUST00000102538] [ENSMUST00000110906] [ENSMUST00000110907] [ENSMUST00000110908]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028639
AA Change: D256V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028639
Gene: ENSMUSG00000027210
AA Change: D256V

Domain	Start	End	E-Value	Type
Pfam:Meis_PKNOX_N	110	194	3.8e-48	PFAM
HOX	276	341	4.27e-12	SMART
low complexity region	395	402	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000074285
AA Change: D255V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000073898
Gene: ENSMUSG00000027210
AA Change: D255V

Domain	Start	End	E-Value	Type
HOX	275	340	4.27e-12	SMART
low complexity region	375	388	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102538
AA Change: D256V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099597
Gene: ENSMUSG00000027210
AA Change: D256V

Domain	Start	End	E-Value	Type
HOX	276	341	4.27e-12	SMART
low complexity region	388	395	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110906
AA Change: D255V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106531
Gene: ENSMUSG00000027210
AA Change: D255V

Domain	Start	End	E-Value	Type
HOX	275	340	4.27e-12	SMART
low complexity region	382	395	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110907
AA Change: D256V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106532
Gene: ENSMUSG00000027210
AA Change: D256V

Domain	Start	End	E-Value	Type
HOX	276	341	4.27e-12	SMART
low complexity region	383	396	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110908
AA Change: D256V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000106533
Gene: ENSMUSG00000027210
AA Change: D256V

Domain	Start	End	E-Value	Type
HOX	276	341	4.27e-12	SMART
low complexity region	376	389	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140461

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151279

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154671

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcriptional regulators and several members have been shown to be essential contributors to developmental programs. In mice, a knock-out of this gene leads to lethality at embryonic day 14, accompanied with hemorrhaging. Embryos lacking this gene show defects in tissues derived from the neural crest, suggesting a critical role of this gene during cranial and cardiac neural crest cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele display early fetal lethality with hemorrhaging, persistent truncus arteriosis, absence of cardic valves and defects in other neural crest cell derived tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	A	T	11: 100,481,755	I902N	possibly damaging	Het
Acsl6	A	G	11: 54,323,308	D88G	probably damaging	Het
Adam1a	A	C	5: 121,519,643	I529S	probably benign	Het
Ap3b1	T	C	13: 94,501,927	V838A	unknown	Het
Arrdc2	T	C	8: 70,837,120	Y280C	probably damaging	Het
Atg10	T	C	13: 91,154,261	T53A	probably benign	Het
Ccdc136	T	C	6: 29,415,584	S699P	probably damaging	Het
Cdc23	C	A	18: 34,636,326	V462L	possibly damaging	Het
Clcn6	C	T	4: 148,014,594	A431T	probably benign	Het
Cntn6	T	G	6: 104,832,580	H525Q	possibly damaging	Het
Ctr9	T	C	7: 111,042,853	F296S	possibly damaging	Het
Ctsq	T	A	13: 61,036,172		probably null	Het
Ehd1	A	G	19: 6,298,300	D436G	probably benign	Het
Epha6	A	T	16: 60,424,904	F311I	probably damaging	Het
Esrrg	A	T	1: 188,066,385	T150S	possibly damaging	Het
Exoc2	C	A	13: 30,856,761	R758L	possibly damaging	Het
Exosc7	G	C	9: 123,131,993	V242L	probably benign	Het
Fcho2	T	C	13: 98,784,807	D190G	possibly damaging	Het
Fgd6	T	C	10: 94,045,032	S583P	probably damaging	Het
Frmd4a	A	G	2: 4,473,188	Y60C	probably damaging	Het
Gldc	A	T	19: 30,113,750	I815N	probably damaging	Het
Grm2	A	T	9: 106,650,914	L257Q	probably damaging	Het
Hectd3	C	A	4: 116,997,020	T289K	possibly damaging	Het
Itgb4	T	C	11: 115,980,991	V207A	probably damaging	Het
Lamb3	A	G	1: 193,330,796	E443G	probably damaging	Het
Muc4	A	G	16: 32,754,686	N1520S	probably benign	Het
Nckap1l	A	G	15: 103,478,854	R719G	probably null	Het
Olfr800	A	T	10: 129,660,225	R140*	probably null	Het
Pabpc6	A	T	17: 9,667,813	M603K	probably damaging	Het
Pcnx2	C	A	8: 125,759,273	R1862L	probably benign	Het
Pon2	T	C	6: 5,273,003	D122G	probably benign	Het
Ppig	T	A	2: 69,749,081	W378R	unknown	Het
Ralgapa1	T	A	12: 55,770,703	E389D	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rarg	A	G	15: 102,239,941	F233L	probably damaging	Het
Rasgrp2	T	C	19: 6,403,460	F90L	possibly damaging	Het
Rrp12	T	A	19: 41,863,241	H1285L	probably benign	Het
Slc16a13	C	A	11: 70,219,082	A198S	probably benign	Het
Spag9	A	G	11: 94,097,233	D441G	probably damaging	Het
Stxbp5l	A	G	16: 37,116,052	F1099S	probably damaging	Het
Tex19.1	T	A	11: 121,147,253	W146R	probably damaging	Het
Tmem8	T	A	17: 26,118,407	I399N	possibly damaging	Het
Tmod3	T	C	9: 75,511,163	D197G	probably benign	Het
Tpp2	A	G	1: 43,975,433	H644R	probably benign	Het
Trpm2	A	G	10: 77,943,076	V352A	possibly damaging	Het
Tulp1	T	C	17: 28,362,701	K233E	probably damaging	Het
Vsir	A	G	10: 60,357,958	T67A	possibly damaging	Het
Wdr49	T	C	3: 75,396,941	N487S	probably benign	Het
Zbtb20	A	G	16: 43,609,423	N99S	probably damaging	Het
Zfp583	C	T	7: 6,317,009	G335S	probably benign	Het
Zgrf1	T	A	3: 127,561,026	V98E	possibly damaging	Het

Other mutations in Meis2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Meis2	APN	2	115868793	missense	probably damaging	1.00
IGL00708:Meis2	APN	2	115864244	missense	probably benign	0.11
IGL01095:Meis2	APN	2	115864424	missense	probably benign
IGL02199:Meis2	APN	2	116000256	missense	probably benign	0.01
IGL02562:Meis2	APN	2	116049146	missense	probably damaging	1.00
IGL02902:Meis2	APN	2	116063323	missense	probably damaging	0.96
IGL03183:Meis2	APN	2	116059521	missense	probably damaging	0.98
IGL03205:Meis2	APN	2	115864250	missense	probably benign	0.08
P4748:Meis2	UTSW	2	115864480	missense	probably benign	0.03
R0369:Meis2	UTSW	2	116063416	missense	possibly damaging	0.82
R0410:Meis2	UTSW	2	115864228	makesense	probably null
R1465:Meis2	UTSW	2	116058670	missense	probably benign	0.03
R1465:Meis2	UTSW	2	116058670	missense	probably benign	0.03
R1548:Meis2	UTSW	2	116058702	missense	probably damaging	0.97
R3835:Meis2	UTSW	2	115921747	missense	probably damaging	1.00
R4353:Meis2	UTSW	2	116059563	missense	probably damaging	0.99
R4756:Meis2	UTSW	2	116000205	missense	probably damaging	1.00
R4936:Meis2	UTSW	2	115864412	missense	probably benign
R5841:Meis2	UTSW	2	116058664	missense	probably benign
R5967:Meis2	UTSW	2	115864309	missense	probably benign	0.04
R6661:Meis2	UTSW	2	115864270	missense	probably damaging	0.97
R6781:Meis2	UTSW	2	116049155	missense	probably benign	0.20
R7239:Meis2	UTSW	2	116059003	splice site	probably null
R7606:Meis2	UTSW	2	116063320	missense	possibly damaging	0.93
R7919:Meis2	UTSW	2	115867307	missense	probably benign	0.01
R8134:Meis2	UTSW	2	115866888	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- AATGTGACCGCTATACAAGTCACCAG -3'
(R):5'- CAAAGAGCTACCGCTCTGTGTCAAG -3'

Sequencing Primer
(F):5'- aagaaaaaaaggaaggaaggaagg -3'
(R):5'- TTAATGATATGGGCGAGTGTGAGAC -3'

Posted On

2014-04-24