Incidental Mutation 'R1593:Meis2'
ID175599
Institutional Source Beutler Lab
Gene Symbol Meis2
Ensembl Gene ENSMUSG00000027210
Gene NameMeis homeobox 2
SynonymsStra10, Meis2, A430109D20Rik, Mrg1
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R1593 (G1)
Quality Score208
Status Not validated
Chromosome2
Chromosomal Location115863064-116065839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116000264 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 256 (D256V)
Ref Sequence ENSEMBL: ENSMUSP00000106532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028639] [ENSMUST00000074285] [ENSMUST00000102538] [ENSMUST00000110906] [ENSMUST00000110907] [ENSMUST00000110908]
Predicted Effect probably damaging
Transcript: ENSMUST00000028639
AA Change: D256V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028639
Gene: ENSMUSG00000027210
AA Change: D256V

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 110 194 3.8e-48 PFAM
HOX 276 341 4.27e-12 SMART
low complexity region 395 402 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074285
AA Change: D255V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073898
Gene: ENSMUSG00000027210
AA Change: D255V

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 375 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102538
AA Change: D256V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099597
Gene: ENSMUSG00000027210
AA Change: D256V

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 388 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110906
AA Change: D255V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106531
Gene: ENSMUSG00000027210
AA Change: D255V

DomainStartEndE-ValueType
HOX 275 340 4.27e-12 SMART
low complexity region 382 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110907
AA Change: D256V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106532
Gene: ENSMUSG00000027210
AA Change: D256V

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 383 396 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110908
AA Change: D256V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106533
Gene: ENSMUSG00000027210
AA Change: D256V

DomainStartEndE-ValueType
HOX 276 341 4.27e-12 SMART
low complexity region 376 389 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154671
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcriptional regulators and several members have been shown to be essential contributors to developmental programs. In mice, a knock-out of this gene leads to lethality at embryonic day 14, accompanied with hemorrhaging. Embryos lacking this gene show defects in tissues derived from the neural crest, suggesting a critical role of this gene during cranial and cardiac neural crest cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele display early fetal lethality with hemorrhaging, persistent truncus arteriosis, absence of cardic valves and defects in other neural crest cell derived tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Meis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Meis2 APN 2 115868793 missense probably damaging 1.00
IGL00708:Meis2 APN 2 115864244 missense probably benign 0.11
IGL01095:Meis2 APN 2 115864424 missense probably benign
IGL02199:Meis2 APN 2 116000256 missense probably benign 0.01
IGL02562:Meis2 APN 2 116049146 missense probably damaging 1.00
IGL02902:Meis2 APN 2 116063323 missense probably damaging 0.96
IGL03183:Meis2 APN 2 116059521 missense probably damaging 0.98
IGL03205:Meis2 APN 2 115864250 missense probably benign 0.08
P4748:Meis2 UTSW 2 115864480 missense probably benign 0.03
R0369:Meis2 UTSW 2 116063416 missense possibly damaging 0.82
R0410:Meis2 UTSW 2 115864228 makesense probably null
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1465:Meis2 UTSW 2 116058670 missense probably benign 0.03
R1548:Meis2 UTSW 2 116058702 missense probably damaging 0.97
R3835:Meis2 UTSW 2 115921747 missense probably damaging 1.00
R4353:Meis2 UTSW 2 116059563 missense probably damaging 0.99
R4756:Meis2 UTSW 2 116000205 missense probably damaging 1.00
R4936:Meis2 UTSW 2 115864412 missense probably benign
R5841:Meis2 UTSW 2 116058664 missense probably benign
R5967:Meis2 UTSW 2 115864309 missense probably benign 0.04
R6661:Meis2 UTSW 2 115864270 missense probably damaging 0.97
R6781:Meis2 UTSW 2 116049155 missense probably benign 0.20
R7239:Meis2 UTSW 2 116059003 intron probably null
R7606:Meis2 UTSW 2 116063320 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATGTGACCGCTATACAAGTCACCAG -3'
(R):5'- CAAAGAGCTACCGCTCTGTGTCAAG -3'

Sequencing Primer
(F):5'- aagaaaaaaaggaaggaaggaagg -3'
(R):5'- TTAATGATATGGGCGAGTGTGAGAC -3'
Posted On2014-04-24