Incidental Mutation 'R1593:Zgrf1'
ID175601
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1593 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127561026 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 98 (V98E)
Ref Sequence ENSEMBL: ENSMUSP00000143585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000195955] [ENSMUST00000196141] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043108
AA Change: V98E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: V98E

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195955
AA Change: V98E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142886
Gene: ENSMUSG00000051278
AA Change: V98E

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 1.6e-25 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196141
AA Change: V98E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: V98E

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196949
Predicted Effect possibly damaging
Transcript: ENSMUST00000199888
AA Change: V98E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278
AA Change: V98E

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200490
AA Change: V98E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278
AA Change: V98E

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1298:Zgrf1 UTSW 3 127583889 missense possibly damaging 0.95
R1353:Zgrf1 UTSW 3 127611803 missense probably damaging 1.00
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3236:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4457:Zgrf1 UTSW 3 127595929 missense probably damaging 1.00
R4498:Zgrf1 UTSW 3 127586100 nonsense probably null
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5256:Zgrf1 UTSW 3 127602445 missense probably damaging 1.00
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7272:Zgrf1 UTSW 3 127598760 missense probably damaging 0.99
R7298:Zgrf1 UTSW 3 127583650 nonsense probably null
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGAACAGTTGAAGGATTTGCTGCTTGA -3'
(R):5'- GGGCCAGGGTTCTCATCACCAA -3'

Sequencing Primer
(F):5'- ACTGCATCTTGTTCATTGCTGG -3'
(R):5'- ttcaaatgctatcccaaaagtcc -3'
Posted On2014-04-24