Incidental Mutation 'R1593:Cntn6'
ID175608
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Namecontactin 6
SynonymsNB-3
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1593 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location104492790-104863406 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104832580 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 525 (H525Q)
Ref Sequence ENSEMBL: ENSMUSP00000124025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089215
AA Change: H525Q

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: H525Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161070
AA Change: H453Q

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: H453Q

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162872
AA Change: H525Q

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: H525Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104650400 missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104774523 missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104728374 splice site probably benign
IGL02028:Cntn6 APN 6 104859426 missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104846142 critical splice donor site probably null
IGL02557:Cntn6 APN 6 104774535 missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104804386 missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104804338 missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104776457 splice site probably benign
PIT4366001:Cntn6 UTSW 6 104832537 missense probably benign 0.05
R0490:Cntn6 UTSW 6 104833918 missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104776314 missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104863148 missense probably benign 0.00
R0654:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R0960:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R1241:Cntn6 UTSW 6 104832509 missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104861900 missense probably benign 0.07
R1401:Cntn6 UTSW 6 104804398 missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R1542:Cntn6 UTSW 6 104848100 missense probably damaging 1.00
R1840:Cntn6 UTSW 6 104774480 missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104861822 nonsense probably null
R2097:Cntn6 UTSW 6 104861949 missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104569028 start gained probably benign
R2429:Cntn6 UTSW 6 104650565 missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104726237 missense probably benign 0.04
R4009:Cntn6 UTSW 6 104833822 missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104772561 missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4666:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4701:Cntn6 UTSW 6 104804360 missense probably benign 0.01
R4780:Cntn6 UTSW 6 104845784 missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104859475 missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104774474 missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104772597 missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104833030 missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104569113 intron probably benign
R5291:Cntn6 UTSW 6 104726135 missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104832562 missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104835745 missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104833103 missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104848132 missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104767890 missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104726139 missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104650500 missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104859448 missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104861946 missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104845758 frame shift probably null
R7012:Cntn6 UTSW 6 104726262 missense probably damaging 0.98
R7012:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R7337:Cntn6 UTSW 6 104650530 missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104650483 missense probably benign 0.29
R8133:Cntn6 UTSW 6 104728337 missense probably benign 0.19
R8463:Cntn6 UTSW 6 104772619 missense possibly damaging 0.64
X0020:Cntn6 UTSW 6 104767884 missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104832584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGTGGTTCGCTCTGCCTTTAATAA -3'
(R):5'- GCTACAGCAGACAAGCGTTCTAGTGT -3'

Sequencing Primer
(F):5'- CGCTCTGCCTTTAATAATAGCATAC -3'
(R):5'- CCCAGATAGAGATTCTGCCTGTG -3'
Posted On2014-04-24