Incidental Mutation 'R1593:Zfp583'
ID175609
Institutional Source Beutler Lab
Gene Symbol Zfp583
Ensembl Gene ENSMUSG00000030443
Gene Namezinc finger protein 583
Synonyms
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R1593 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6315660-6331285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6317009 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 335 (G335S)
Ref Sequence ENSEMBL: ENSMUSP00000129551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062765] [ENSMUST00000108560] [ENSMUST00000165705]
Predicted Effect probably benign
Transcript: ENSMUST00000062765
AA Change: G335S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000053935
Gene: ENSMUSG00000030443
AA Change: G335S

DomainStartEndE-ValueType
KRAB 6 66 7.45e-32 SMART
ZnF_C2H2 211 233 2.09e-3 SMART
ZnF_C2H2 239 261 3.89e-3 SMART
ZnF_C2H2 267 289 2.95e-3 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 7.26e-3 SMART
ZnF_C2H2 351 373 2.61e-4 SMART
ZnF_C2H2 379 401 2.75e-3 SMART
ZnF_C2H2 407 429 2.57e-3 SMART
ZnF_C2H2 435 457 2.09e-3 SMART
ZnF_C2H2 463 485 1.58e-3 SMART
ZnF_C2H2 491 513 3.44e-4 SMART
ZnF_C2H2 519 541 1.36e-2 SMART
low complexity region 545 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108560
AA Change: G335S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104200
Gene: ENSMUSG00000030443
AA Change: G335S

DomainStartEndE-ValueType
KRAB 6 66 7.45e-32 SMART
ZnF_C2H2 211 233 2.09e-3 SMART
ZnF_C2H2 239 261 3.89e-3 SMART
ZnF_C2H2 267 289 2.95e-3 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 7.26e-3 SMART
ZnF_C2H2 351 373 2.61e-4 SMART
ZnF_C2H2 379 401 2.75e-3 SMART
ZnF_C2H2 407 429 2.57e-3 SMART
ZnF_C2H2 435 457 2.09e-3 SMART
ZnF_C2H2 463 485 1.58e-3 SMART
ZnF_C2H2 491 513 3.44e-4 SMART
ZnF_C2H2 519 541 1.36e-2 SMART
low complexity region 545 561 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123868
Predicted Effect probably benign
Transcript: ENSMUST00000165705
AA Change: G335S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129551
Gene: ENSMUSG00000030443
AA Change: G335S

DomainStartEndE-ValueType
KRAB 6 66 7.45e-32 SMART
ZnF_C2H2 211 233 2.09e-3 SMART
ZnF_C2H2 239 261 3.89e-3 SMART
ZnF_C2H2 267 289 2.95e-3 SMART
ZnF_C2H2 295 317 1.2e-3 SMART
ZnF_C2H2 323 345 7.26e-3 SMART
ZnF_C2H2 351 373 2.61e-4 SMART
ZnF_C2H2 379 401 2.75e-3 SMART
ZnF_C2H2 407 429 2.57e-3 SMART
ZnF_C2H2 435 457 2.09e-3 SMART
ZnF_C2H2 463 485 1.58e-3 SMART
ZnF_C2H2 491 513 3.44e-4 SMART
ZnF_C2H2 519 541 1.36e-2 SMART
low complexity region 545 561 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Zfp583
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Zfp583 APN 7 6317185 missense probably damaging 1.00
IGL01921:Zfp583 APN 7 6325570 missense possibly damaging 0.95
R2188:Zfp583 UTSW 7 6317611 missense probably benign
R4377:Zfp583 UTSW 7 6317681 missense possibly damaging 0.61
R5000:Zfp583 UTSW 7 6325474 missense probably damaging 1.00
R5031:Zfp583 UTSW 7 6317398 missense probably benign
R5723:Zfp583 UTSW 7 6323675 missense probably damaging 0.98
R6603:Zfp583 UTSW 7 6325476 missense probably damaging 1.00
R7325:Zfp583 UTSW 7 6316586 missense probably damaging 0.99
R7391:Zfp583 UTSW 7 6316499 missense probably damaging 1.00
R7673:Zfp583 UTSW 7 6317010 missense possibly damaging 0.91
RF024:Zfp583 UTSW 7 6316982 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACGCTGCCTGAACGatttcct -3'
(R):5'- CAGAGTGAGCCACAAAAGAGAAGTTACC -3'

Sequencing Primer
(F):5'- ctctcctgtgtgacttctctg -3'
(R):5'- cctcatcccttacactccatc -3'
Posted On2014-04-24