Mutagenetix > Incidental Mutation

Incidental Mutation 'R1593:Ctr9'

175611

Institutional Source

Beutler Lab

Gene Symbol

Ctr9

Ensembl Gene

ENSMUSG00000005609

Gene Name

CTR9 homolog, Paf1/RNA polymerase II complex component

Synonyms

Tsbp, Tsp, Sh2bp1

MMRRC Submission

039630-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1593 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111028951-111056377 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 111042853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 296 (F296S)

Ref Sequence

ENSEMBL: ENSMUSP00000005749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005749]

AlphaFold

Q62018

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005749
AA Change: F296S

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000005749
Gene: ENSMUSG00000005609
AA Change: F296S

Domain	Start	End	E-Value	Type
TPR	163	196	2.26e-3	SMART
TPR	198	231	2e-4	SMART
low complexity region	232	241	N/A	INTRINSIC
TPR	306	339	4.52e-3	SMART
TPR	341	374	1.39e-3	SMART
TPR	451	484	3.56e-1	SMART
TPR	497	530	7.34e-3	SMART
TPR	531	564	3.24e-4	SMART
Blast:TPR	565	598	2e-14	BLAST
TPR	681	714	9.03e-3	SMART
TPR	717	750	1.6e1	SMART
coiled coil region	828	889	N/A	INTRINSIC
low complexity region	892	916	N/A	INTRINSIC
low complexity region	923	928	N/A	INTRINSIC
low complexity region	932	1002	N/A	INTRINSIC
low complexity region	1005	1028	N/A	INTRINSIC
low complexity region	1034	1050	N/A	INTRINSIC
low complexity region	1072	1090	N/A	INTRINSIC
low complexity region	1133	1159	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146558

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152019

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157025

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the PAF1 complex, which associates with RNA polymerase II and functions in transcriptional regulation and elongation. This complex also plays a role in the modification of histones. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	A	T	11: 100,481,755	I902N	possibly damaging	Het
Acsl6	A	G	11: 54,323,308	D88G	probably damaging	Het
Adam1a	A	C	5: 121,519,643	I529S	probably benign	Het
Ap3b1	T	C	13: 94,501,927	V838A	unknown	Het
Arrdc2	T	C	8: 70,837,120	Y280C	probably damaging	Het
Atg10	T	C	13: 91,154,261	T53A	probably benign	Het
Ccdc136	T	C	6: 29,415,584	S699P	probably damaging	Het
Cdc23	C	A	18: 34,636,326	V462L	possibly damaging	Het
Clcn6	C	T	4: 148,014,594	A431T	probably benign	Het
Cntn6	T	G	6: 104,832,580	H525Q	possibly damaging	Het
Ctsq	T	A	13: 61,036,172		probably null	Het
Ehd1	A	G	19: 6,298,300	D436G	probably benign	Het
Epha6	A	T	16: 60,424,904	F311I	probably damaging	Het
Esrrg	A	T	1: 188,066,385	T150S	possibly damaging	Het
Exoc2	C	A	13: 30,856,761	R758L	possibly damaging	Het
Exosc7	G	C	9: 123,131,993	V242L	probably benign	Het
Fcho2	T	C	13: 98,784,807	D190G	possibly damaging	Het
Fgd6	T	C	10: 94,045,032	S583P	probably damaging	Het
Frmd4a	A	G	2: 4,473,188	Y60C	probably damaging	Het
Gldc	A	T	19: 30,113,750	I815N	probably damaging	Het
Grm2	A	T	9: 106,650,914	L257Q	probably damaging	Het
Hectd3	C	A	4: 116,997,020	T289K	possibly damaging	Het
Itgb4	T	C	11: 115,980,991	V207A	probably damaging	Het
Lamb3	A	G	1: 193,330,796	E443G	probably damaging	Het
Meis2	T	A	2: 116,000,264	D256V	probably damaging	Het
Muc4	A	G	16: 32,754,686	N1520S	probably benign	Het
Nckap1l	A	G	15: 103,478,854	R719G	probably null	Het
Olfr800	A	T	10: 129,660,225	R140*	probably null	Het
Pabpc6	A	T	17: 9,667,813	M603K	probably damaging	Het
Pcnx2	C	A	8: 125,759,273	R1862L	probably benign	Het
Pon2	T	C	6: 5,273,003	D122G	probably benign	Het
Ppig	T	A	2: 69,749,081	W378R	unknown	Het
Ralgapa1	T	A	12: 55,770,703	E389D	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rarg	A	G	15: 102,239,941	F233L	probably damaging	Het
Rasgrp2	T	C	19: 6,403,460	F90L	possibly damaging	Het
Rrp12	T	A	19: 41,863,241	H1285L	probably benign	Het
Slc16a13	C	A	11: 70,219,082	A198S	probably benign	Het
Spag9	A	G	11: 94,097,233	D441G	probably damaging	Het
Stxbp5l	A	G	16: 37,116,052	F1099S	probably damaging	Het
Tex19.1	T	A	11: 121,147,253	W146R	probably damaging	Het
Tmem8	T	A	17: 26,118,407	I399N	possibly damaging	Het
Tmod3	T	C	9: 75,511,163	D197G	probably benign	Het
Tpp2	A	G	1: 43,975,433	H644R	probably benign	Het
Trpm2	A	G	10: 77,943,076	V352A	possibly damaging	Het
Tulp1	T	C	17: 28,362,701	K233E	probably damaging	Het
Vsir	A	G	10: 60,357,958	T67A	possibly damaging	Het
Wdr49	T	C	3: 75,396,941	N487S	probably benign	Het
Zbtb20	A	G	16: 43,609,423	N99S	probably damaging	Het
Zfp583	C	T	7: 6,317,009	G335S	probably benign	Het
Zgrf1	T	A	3: 127,561,026	V98E	possibly damaging	Het

Other mutations in Ctr9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01603:Ctr9	APN	7	111049331	missense	probably damaging	1.00
IGL02379:Ctr9	APN	7	111051519	missense	probably damaging	0.99
IGL02451:Ctr9	APN	7	111043424	nonsense	probably null
IGL03222:Ctr9	APN	7	111043050	missense	probably benign	0.41
R0023:Ctr9	UTSW	7	111043947	missense	possibly damaging	0.83
R0023:Ctr9	UTSW	7	111043947	missense	possibly damaging	0.83
R0586:Ctr9	UTSW	7	111049498	splice site	probably benign
R0761:Ctr9	UTSW	7	111046272	missense	probably damaging	0.97
R0834:Ctr9	UTSW	7	111050952	missense	probably benign	0.06
R1711:Ctr9	UTSW	7	111055663	missense	unknown
R1828:Ctr9	UTSW	7	111043958	splice site	probably null
R1838:Ctr9	UTSW	7	111052303	missense	possibly damaging	0.93
R2037:Ctr9	UTSW	7	111046807	missense	probably benign	0.04
R2171:Ctr9	UTSW	7	111046910	missense	possibly damaging	0.69
R2512:Ctr9	UTSW	7	111046871	missense	probably damaging	1.00
R2850:Ctr9	UTSW	7	111053446	missense	unknown
R2851:Ctr9	UTSW	7	111053446	missense	unknown
R3124:Ctr9	UTSW	7	111053446	missense	unknown
R4049:Ctr9	UTSW	7	111055543	missense	unknown
R4280:Ctr9	UTSW	7	111046723	intron	probably benign
R4350:Ctr9	UTSW	7	111049318	missense	probably damaging	1.00
R4352:Ctr9	UTSW	7	111049318	missense	probably damaging	1.00
R4460:Ctr9	UTSW	7	111046894	missense	probably benign	0.01
R4740:Ctr9	UTSW	7	111035371	missense	probably benign	0.31
R5039:Ctr9	UTSW	7	111042857	missense	probably benign	0.28
R5216:Ctr9	UTSW	7	111045458	missense	possibly damaging	0.68
R5647:Ctr9	UTSW	7	111055544	missense	unknown
R5677:Ctr9	UTSW	7	111044002	missense	probably benign	0.45
R6907:Ctr9	UTSW	7	111030242	missense	probably damaging	1.00
R7371:Ctr9	UTSW	7	111033807	missense	probably damaging	0.99
R7391:Ctr9	UTSW	7	111043171	nonsense	probably null
R7405:Ctr9	UTSW	7	111043714	missense	possibly damaging	0.90
R7406:Ctr9	UTSW	7	111053408	missense	unknown
R7502:Ctr9	UTSW	7	111033926	missense	probably benign	0.26
R7760:Ctr9	UTSW	7	111046601	missense	probably damaging	1.00
R7814:Ctr9	UTSW	7	111033927	missense	probably benign	0.08
R7870:Ctr9	UTSW	7	111052411	missense	unknown
R8026:Ctr9	UTSW	7	111033892	missense	probably damaging	1.00
R8035:Ctr9	UTSW	7	111034457	missense	probably damaging	1.00
R8066:Ctr9	UTSW	7	111033897	nonsense	probably null
R8080:Ctr9	UTSW	7	111051567	missense	possibly damaging	0.91
R8789:Ctr9	UTSW	7	111043726	missense	possibly damaging	0.82
R8840:Ctr9	UTSW	7	111043030	missense	probably damaging	0.96
R9015:Ctr9	UTSW	7	111043901	missense	probably benign	0.01
Z1088:Ctr9	UTSW	7	111030224	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGCTGCATCATTCTTGATTGCTGC -3'
(R):5'- CGTAAGCTGCGTAAGAAGCCCCA -3'

Sequencing Primer
(F):5'- CATTCTTGATTGCTGCTTGTTACAG -3'
(R):5'- CCTGATCTTCTGAAGCAGCATAG -3'

Posted On

2014-04-24