Incidental Mutation 'R1593:Grm2'
ID175616
Institutional Source Beutler Lab
Gene Symbol Grm2
Ensembl Gene ENSMUSG00000023192
Gene Nameglutamate receptor, metabotropic 2
Synonyms4930441L02Rik, mGluR2, Gprc1b
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R1593 (G1)
Quality Score88
Status Not validated
Chromosome9
Chromosomal Location106643095-106656082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106650914 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 257 (L257Q)
Ref Sequence ENSEMBL: ENSMUSP00000023959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023959] [ENSMUST00000201681]
Predicted Effect probably damaging
Transcript: ENSMUST00000023959
AA Change: L257Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023959
Gene: ENSMUSG00000023192
AA Change: L257Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 1.3e-96 PFAM
Pfam:NCD3G 496 546 3.7e-13 PFAM
Pfam:7tm_3 579 816 4.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200826
Predicted Effect probably damaging
Transcript: ENSMUST00000201681
AA Change: L257Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144631
Gene: ENSMUSG00000023192
AA Change: L257Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 60 460 4.1e-95 PFAM
Pfam:7tm_3 458 538 4.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201955
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile behavioral modifications and moderate abnormalities in long term depression and EPSP in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Grm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1053:Grm2 UTSW 9 106648157 missense probably damaging 0.98
R1116:Grm2 UTSW 9 106647927 missense probably damaging 0.97
R1619:Grm2 UTSW 9 106647471 missense probably damaging 1.00
R2174:Grm2 UTSW 9 106647795 missense probably benign 0.05
R2357:Grm2 UTSW 9 106647581 missense probably damaging 0.99
R3115:Grm2 UTSW 9 106647623 missense probably damaging 0.97
R4453:Grm2 UTSW 9 106653879 missense probably damaging 0.97
R4700:Grm2 UTSW 9 106653931 missense probably benign 0.18
R4854:Grm2 UTSW 9 106654132 missense possibly damaging 0.80
R4871:Grm2 UTSW 9 106647645 missense probably benign 0.00
R4888:Grm2 UTSW 9 106650666 missense probably damaging 0.98
R4999:Grm2 UTSW 9 106653990 missense probably damaging 1.00
R5617:Grm2 UTSW 9 106651076 unclassified probably null
R5620:Grm2 UTSW 9 106650446 missense probably damaging 0.96
R6021:Grm2 UTSW 9 106650800 missense probably damaging 1.00
R6089:Grm2 UTSW 9 106653891 missense probably damaging 1.00
R6662:Grm2 UTSW 9 106648053 missense probably benign 0.01
R7061:Grm2 UTSW 9 106651225 missense probably damaging 0.98
R7266:Grm2 UTSW 9 106647171 missense
R7270:Grm2 UTSW 9 106651058 missense probably damaging 0.98
R7479:Grm2 UTSW 9 106653851 missense possibly damaging 0.84
R7542:Grm2 UTSW 9 106651169 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGGAGGCCAGCTCAATGGTGATG -3'
(R):5'- TCCAGATCCCACAGATCAGCTATGC -3'

Sequencing Primer
(F):5'- AGGTGAAGCTGGCGTTGAG -3'
(R):5'- GCGACAAGTCCCGTTATGATTAC -3'
Posted On2014-04-24