Incidental Mutation 'R1593:Olfr800'
ID175622
Institutional Source Beutler Lab
Gene Symbol Olfr800
Ensembl Gene ENSMUSG00000108114
Gene Nameolfactory receptor 800
SynonymsGA_x6K02T2PULF-11338429-11339364, MOR114-7
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R1593 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129657694-129662074 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 129660225 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 140 (R140*)
Ref Sequence ENSEMBL: ENSMUSP00000151047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104903] [ENSMUST00000217094]
Predicted Effect probably null
Transcript: ENSMUST00000104903
AA Change: R140*
SMART Domains Protein: ENSMUSP00000100499
Gene: ENSMUSG00000108114
AA Change: R140*

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 7.3e-43 PFAM
Pfam:7tm_1 38 287 6.9e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217094
AA Change: R140*
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Olfr800
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr800 APN 10 129660126 missense probably benign 0.26
IGL01915:Olfr800 APN 10 129660650 missense probably benign 0.05
IGL02458:Olfr800 APN 10 129660606 missense probably benign 0.38
IGL02721:Olfr800 APN 10 129659955 missense probably benign
R0032:Olfr800 UTSW 10 129660400 missense probably benign 0.05
R0442:Olfr800 UTSW 10 129659824 missense probably benign 0.00
R1564:Olfr800 UTSW 10 129660015 missense probably benign 0.22
R1580:Olfr800 UTSW 10 129660315 missense probably benign 0.10
R1911:Olfr800 UTSW 10 129660112 missense probably benign 0.07
R2001:Olfr800 UTSW 10 129660421 missense probably benign 0.02
R2223:Olfr800 UTSW 10 129659809 start codon destroyed probably null 1.00
R3876:Olfr800 UTSW 10 129660274 missense probably benign 0.39
R3884:Olfr800 UTSW 10 129660538 missense probably damaging 1.00
R4366:Olfr800 UTSW 10 129660531 missense probably benign 0.02
R4689:Olfr800 UTSW 10 129660316 missense probably benign 0.01
R4909:Olfr800 UTSW 10 129660720 missense probably benign 0.01
R5638:Olfr800 UTSW 10 129660100 missense possibly damaging 0.80
R5835:Olfr800 UTSW 10 129659934 missense probably benign 0.39
R5838:Olfr800 UTSW 10 129660038 missense probably benign 0.41
R6150:Olfr800 UTSW 10 129659934 missense probably benign 0.39
R6248:Olfr800 UTSW 10 129660663 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AGCTACGTGCTGAGTATGACTGGG -3'
(R):5'- GCTGCCATAGGTGATGGAAACCAC -3'

Sequencing Primer
(F):5'- CTGAGTATGACTGGGAACCTCAC -3'
(R):5'- CAGAAGGAAATCTTAGAATGGTCCTG -3'
Posted On2014-04-24