Incidental Mutation 'R1593:Rarg'
ID175637
Institutional Source Beutler Lab
Gene Symbol Rarg
Ensembl Gene ENSMUSG00000001288
Gene Nameretinoic acid receptor, gamma
SynonymsRAR gamma 2, RARgamma2
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R1593 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102234938-102257517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102239941 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 233 (F233L)
Ref Sequence ENSEMBL: ENSMUSP00000067266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043172] [ENSMUST00000063339] [ENSMUST00000130204] [ENSMUST00000135466] [ENSMUST00000155563]
Predicted Effect probably damaging
Transcript: ENSMUST00000043172
AA Change: F244L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048838
Gene: ENSMUSG00000001288
AA Change: F244L

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
HOLI 232 390 9.07e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063339
AA Change: F233L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067266
Gene: ENSMUSG00000001288
AA Change: F233L

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
ZnF_C4 76 147 1.53e-40 SMART
HOLI 221 379 9.07e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124224
Predicted Effect probably benign
Transcript: ENSMUST00000130204
Predicted Effect probably benign
Transcript: ENSMUST00000135466
SMART Domains Protein: ENSMUSP00000118615
Gene: ENSMUSG00000001288

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
PDB:1EXX|A 178 227 5e-28 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155563
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinoic acid receptor that belongs to the nuclear hormone receptor family. Retinoic acid receptors (RARs) act as ligand-dependent transcriptional regulators. When bound to ligands, RARs activate transcription by binding as heterodimers to the retinoic acid response elements (RARE) found in the promoter regions of the target genes. In their unbound form, RARs repress transcription of their target genes. RARs are involved in various biological processes, including limb bud development, skeletal growth, and matrix homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit stunted growth, homeotic transformations of the rostral axial skeleton and tracheal cartilage, Harderian gland agenesis, high postnatal mortality, and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Rarg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02877:Rarg APN 15 102241939 splice site probably null
R0033:Rarg UTSW 15 102238835 missense probably damaging 0.99
R0539:Rarg UTSW 15 102238877 missense probably damaging 1.00
R1137:Rarg UTSW 15 102241160 missense probably damaging 1.00
R1916:Rarg UTSW 15 102252445 missense probably benign 0.00
R1926:Rarg UTSW 15 102239545 missense probably damaging 1.00
R2057:Rarg UTSW 15 102239504 missense probably damaging 0.99
R2211:Rarg UTSW 15 102239524 missense probably benign 0.20
R4581:Rarg UTSW 15 102252551 missense possibly damaging 0.70
R5718:Rarg UTSW 15 102241067 missense probably damaging 1.00
R6197:Rarg UTSW 15 102241892 missense possibly damaging 0.94
R6991:Rarg UTSW 15 102241915 missense probably damaging 1.00
R7300:Rarg UTSW 15 102252417 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCCATCCGAGAATGTCATAGTGTC -3'
(R):5'- GAGGAACTCATCACCAAGGTCAGC -3'

Sequencing Primer
(F):5'- CTCCTGAGGAAGGATTCCTAAGTG -3'
(R):5'- TGGGCAAGTACACCACG -3'
Posted On2014-04-24