Mutagenetix > Incidental Mutation

Incidental Mutation 'R1593:Zbtb20'

175641

Institutional Source

Beutler Lab

Gene Symbol

Zbtb20

Ensembl Gene

ENSMUSG00000022708

Gene Name

zinc finger and BTB domain containing 20

Synonyms

Zfp288, D16Wsu73e, 7330412A13Rik, 1300017A20Rik, HOF, A930017C21Rik

MMRRC Submission

039630-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1593 (G1)

Quality Score

122

Status

Not validated

Chromosome

Chromosomal Location

42875881-43642602 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43609423 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 99 (N99S)

Ref Sequence

ENSEMBL: ENSMUSP00000124126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]

AlphaFold

Q8K0L9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079441
AA Change: N99S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: N99S

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114690
AA Change: N26S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: N26S

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART
low complexity region	330	350	N/A	INTRINSIC
ZnF_C2H2	505	527	6.88e-4	SMART
ZnF_C2H2	533	555	4.17e-3	SMART
ZnF_C2H2	561	583	7.6e-6	SMART
ZnF_C2H2	589	611	5.06e-2	SMART
low complexity region	616	635	N/A	INTRINSIC
ZnF_C2H2	642	664	7.9e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114691
AA Change: N26S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: N26S

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART
low complexity region	330	350	N/A	INTRINSIC
ZnF_C2H2	505	527	6.88e-4	SMART
ZnF_C2H2	533	555	4.17e-3	SMART
ZnF_C2H2	561	583	7.6e-6	SMART
ZnF_C2H2	589	611	5.06e-2	SMART
low complexity region	616	635	N/A	INTRINSIC
ZnF_C2H2	642	664	7.9e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114694
AA Change: N99S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: N99S

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114695
AA Change: N99S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: N99S

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146708
AA Change: N26S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708
AA Change: N26S

Domain	Start	End	E-Value	Type
Pfam:BTB	21	74	3.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148775
AA Change: N26S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708
AA Change: N26S

Domain	Start	End	E-Value	Type
Pfam:BTB	21	60	9.8e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000156367
AA Change: N99S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708
AA Change: N99S

Domain	Start	End	E-Value	Type
Pfam:BTB	94	131	1.1e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156981
AA Change: N26S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708
AA Change: N26S

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	A	T	11: 100,481,755	I902N	possibly damaging	Het
Acsl6	A	G	11: 54,323,308	D88G	probably damaging	Het
Adam1a	A	C	5: 121,519,643	I529S	probably benign	Het
Ap3b1	T	C	13: 94,501,927	V838A	unknown	Het
Arrdc2	T	C	8: 70,837,120	Y280C	probably damaging	Het
Atg10	T	C	13: 91,154,261	T53A	probably benign	Het
Ccdc136	T	C	6: 29,415,584	S699P	probably damaging	Het
Cdc23	C	A	18: 34,636,326	V462L	possibly damaging	Het
Clcn6	C	T	4: 148,014,594	A431T	probably benign	Het
Cntn6	T	G	6: 104,832,580	H525Q	possibly damaging	Het
Ctr9	T	C	7: 111,042,853	F296S	possibly damaging	Het
Ctsq	T	A	13: 61,036,172		probably null	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha6	A	T	16: 60,424,904	F311I	probably damaging	Het
Esrrg	A	T	1: 188,066,385	T150S	possibly damaging	Het
Exoc2	C	A	13: 30,856,761	R758L	possibly damaging	Het
Exosc7	G	C	9: 123,131,993	V242L	probably benign	Het
Fcho2	T	C	13: 98,784,807	D190G	possibly damaging	Het
Fgd6	T	C	10: 94,045,032	S583P	probably damaging	Het
Frmd4a	A	G	2: 4,473,188	Y60C	probably damaging	Het
Gldc	A	T	19: 30,113,750	I815N	probably damaging	Het
Grm2	A	T	9: 106,650,914	L257Q	probably damaging	Het
Hectd3	C	A	4: 116,997,020	T289K	possibly damaging	Het
Itgb4	T	C	11: 115,980,991	V207A	probably damaging	Het
Lamb3	A	G	1: 193,330,796	E443G	probably damaging	Het
Meis2	T	A	2: 116,000,264	D256V	probably damaging	Het
Muc4	A	G	16: 32,754,686	N1520S	probably benign	Het
Nckap1l	A	G	15: 103,478,854	R719G	probably null	Het
Olfr800	A	T	10: 129,660,225	R140*	probably null	Het
Pabpc6	A	T	17: 9,667,813	M603K	probably damaging	Het
Pcnx2	C	A	8: 125,759,273	R1862L	probably benign	Het
Pon2	T	C	6: 5,273,003	D122G	probably benign	Het
Ppig	T	A	2: 69,749,081	W378R	unknown	Het
Ralgapa1	T	A	12: 55,770,703	E389D	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rarg	A	G	15: 102,239,941	F233L	probably damaging	Het
Rasgrp2	T	C	19: 6,403,460	F90L	possibly damaging	Het
Rrp12	T	A	19: 41,863,241	H1285L	probably benign	Het
Slc16a13	C	A	11: 70,219,082	A198S	probably benign	Het
Spag9	A	G	11: 94,097,233	D441G	probably damaging	Het
Stxbp5l	A	G	16: 37,116,052	F1099S	probably damaging	Het
Tex19.1	T	A	11: 121,147,253	W146R	probably damaging	Het
Tmem8	T	A	17: 26,118,407	I399N	possibly damaging	Het
Tmod3	T	C	9: 75,511,163	D197G	probably benign	Het
Tpp2	A	G	1: 43,975,433	H644R	probably benign	Het
Trpm2	A	G	10: 77,943,076	V352A	possibly damaging	Het
Tulp1	T	C	17: 28,362,701	K233E	probably damaging	Het
Vsir	A	G	10: 60,357,958	T67A	possibly damaging	Het
Wdr49	T	C	3: 75,396,941	N487S	probably benign	Het
Zfp583	C	T	7: 6,317,009	G335S	probably benign	Het
Zgrf1	T	A	3: 127,561,026	V98E	possibly damaging	Het

Other mutations in Zbtb20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01761:Zbtb20	APN	16	43610661	missense	possibly damaging	0.85
IGL02170:Zbtb20	APN	16	43609662	missense	possibly damaging	0.84
IGL02292:Zbtb20	APN	16	43610648	nonsense	probably null
IGL02733:Zbtb20	APN	16	43609933	missense	possibly damaging	0.48
IGL03277:Zbtb20	APN	16	43618437	missense	possibly damaging	0.95
siberian	UTSW	16	43610676	missense	probably damaging	0.96
Tiger	UTSW	16	43618398	missense	probably damaging	0.98
Towering	UTSW	16	43610867	nonsense	probably null
R0310:Zbtb20	UTSW	16	43609746	missense	probably damaging	0.98
R1996:Zbtb20	UTSW	16	43610080	missense	probably damaging	0.98
R2018:Zbtb20	UTSW	16	43577652	missense	possibly damaging	0.86
R2050:Zbtb20	UTSW	16	43609612	splice site	probably null
R2097:Zbtb20	UTSW	16	43609519	missense	probably null	1.00
R4006:Zbtb20	UTSW	16	43609399	missense	probably damaging	1.00
R4708:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R4710:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R4835:Zbtb20	UTSW	16	43618398	missense	probably damaging	0.98
R4962:Zbtb20	UTSW	16	43618692	missense	probably damaging	0.99
R5531:Zbtb20	UTSW	16	43610867	nonsense	probably null
R7452:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R7523:Zbtb20	UTSW	16	43610512	missense	probably benign	0.01
R8175:Zbtb20	UTSW	16	43577080	intron	probably benign
R8306:Zbtb20	UTSW	16	43618737	missense	probably damaging	0.99
R8811:Zbtb20	UTSW	16	43610494	missense	probably benign
R8922:Zbtb20	UTSW	16	43577605	missense	probably damaging	0.99
R9164:Zbtb20	UTSW	16	43610401	missense	probably benign	0.02
R9687:Zbtb20	UTSW	16	43609797	missense	possibly damaging	0.83
Z1176:Zbtb20	UTSW	16	43610530	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- GTGTGTGCAGTATCCCCAGCTTTC -3'
(R):5'- AACACATCGCCCACGTTCTGTGAC -3'

Sequencing Primer
(F):5'- AGCGTTACTCTTCTAAGACCTGAG -3'
(R):5'- CCGCTGTACATGAAGTCAATG -3'

Posted On

2014-04-24