Mutagenetix > Incidental Mutations

Incidental Mutation 'R1593:Epha6'

175642

Institutional Source

Beutler Lab

Gene Symbol

Epha6

Ensembl Gene

ENSMUSG00000055540

Gene Name

Eph receptor A6

Synonyms

m-ehk2, Hek12, Ehk2

MMRRC Submission

039630-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1593 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59653483-60605531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60424904 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 311 (F311I)

Ref Sequence

ENSEMBL: ENSMUSP00000066734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068860]

Predicted Effect

probably damaging
Transcript: ENSMUST00000068860
AA Change: F311I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: F311I

Domain	Start	End	E-Value	Type
low complexity region	4	37	N/A	INTRINSIC
low complexity region	79	90	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
EPH_lbd	128	301	5.95e-125	SMART
Pfam:GCC2_GCC3	361	406	1.6e-8	PFAM
FN3	426	518	5.83e-3	SMART
FN3	537	618	2.19e-7	SMART
Pfam:EphA2_TM	644	722	1.8e-22	PFAM
TyrKc	725	1024	3.66e-122	SMART
SAM	1052	1119	1.24e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159383

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	A	T	11: 100,481,755	I902N	possibly damaging	Het
Acsl6	A	G	11: 54,323,308	D88G	probably damaging	Het
Adam1a	A	C	5: 121,519,643	I529S	probably benign	Het
Ap3b1	T	C	13: 94,501,927	V838A	unknown	Het
Arrdc2	T	C	8: 70,837,120	Y280C	probably damaging	Het
Atg10	T	C	13: 91,154,261	T53A	probably benign	Het
Ccdc136	T	C	6: 29,415,584	S699P	probably damaging	Het
Cdc23	C	A	18: 34,636,326	V462L	possibly damaging	Het
Clcn6	C	T	4: 148,014,594	A431T	probably benign	Het
Cntn6	T	G	6: 104,832,580	H525Q	possibly damaging	Het
Ctr9	T	C	7: 111,042,853	F296S	possibly damaging	Het
Ctsq	T	A	13: 61,036,172		probably null	Het
Ehd1	A	G	19: 6,298,300	D436G	probably benign	Het
Esrrg	A	T	1: 188,066,385	T150S	possibly damaging	Het
Exoc2	C	A	13: 30,856,761	R758L	possibly damaging	Het
Exosc7	G	C	9: 123,131,993	V242L	probably benign	Het
Fcho2	T	C	13: 98,784,807	D190G	possibly damaging	Het
Fgd6	T	C	10: 94,045,032	S583P	probably damaging	Het
Frmd4a	A	G	2: 4,473,188	Y60C	probably damaging	Het
Gldc	A	T	19: 30,113,750	I815N	probably damaging	Het
Grm2	A	T	9: 106,650,914	L257Q	probably damaging	Het
Hectd3	C	A	4: 116,997,020	T289K	possibly damaging	Het
Itgb4	T	C	11: 115,980,991	V207A	probably damaging	Het
Lamb3	A	G	1: 193,330,796	E443G	probably damaging	Het
Meis2	T	A	2: 116,000,264	D256V	probably damaging	Het
Muc4	A	G	16: 32,754,686	N1520S	probably benign	Het
Nckap1l	A	G	15: 103,478,854	R719G	probably null	Het
Olfr800	A	T	10: 129,660,225	R140*	probably null	Het
Pabpc6	A	T	17: 9,667,813	M603K	probably damaging	Het
Pcnx2	C	A	8: 125,759,273	R1862L	probably benign	Het
Pon2	T	C	6: 5,273,003	D122G	probably benign	Het
Ppig	T	A	2: 69,749,081	W378R	unknown	Het
Ralgapa1	T	A	12: 55,770,703	E389D	probably damaging	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rarg	A	G	15: 102,239,941	F233L	probably damaging	Het
Rasgrp2	T	C	19: 6,403,460	F90L	possibly damaging	Het
Rrp12	T	A	19: 41,863,241	H1285L	probably benign	Het
Slc16a13	C	A	11: 70,219,082	A198S	probably benign	Het
Spag9	A	G	11: 94,097,233	D441G	probably damaging	Het
Stxbp5l	A	G	16: 37,116,052	F1099S	probably damaging	Het
Tex19.1	T	A	11: 121,147,253	W146R	probably damaging	Het
Tmem8	T	A	17: 26,118,407	I399N	possibly damaging	Het
Tmod3	T	C	9: 75,511,163	D197G	probably benign	Het
Tpp2	A	G	1: 43,975,433	H644R	probably benign	Het
Trpm2	A	G	10: 77,943,076	V352A	possibly damaging	Het
Tulp1	T	C	17: 28,362,701	K233E	probably damaging	Het
Vsir	A	G	10: 60,357,958	T67A	possibly damaging	Het
Wdr49	T	C	3: 75,396,941	N487S	probably benign	Het
Zbtb20	A	G	16: 43,609,423	N99S	probably damaging	Het
Zfp583	C	T	7: 6,317,009	G335S	probably benign	Het
Zgrf1	T	A	3: 127,561,026	V98E	possibly damaging	Het

Other mutations in Epha6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00475:Epha6	APN	16	59915962	missense	probably damaging	1.00
IGL00849:Epha6	APN	16	60425111	missense	possibly damaging	0.89
IGL00898:Epha6	APN	16	59775541	critical splice donor site	probably null
IGL01353:Epha6	APN	16	60424895	missense	probably damaging	1.00
IGL01409:Epha6	APN	16	59655737	nonsense	probably null
IGL01577:Epha6	APN	16	59956926	missense	possibly damaging	0.57
IGL01653:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01654:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01655:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01657:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL01663:Epha6	APN	16	59775644	missense	probably damaging	1.00
IGL01899:Epha6	APN	16	59839303	missense	probably benign	0.05
IGL02272:Epha6	APN	16	59818937	missense	probably damaging	1.00
IGL03265:Epha6	APN	16	60060231	splice site	probably benign
IGL03333:Epha6	APN	16	59682688	missense	probably damaging	1.00
rauwulfia	UTSW	16	59682616	missense	probably damaging	1.00
PIT4377001:Epha6	UTSW	16	60205552	missense	probably damaging	0.98
R0505:Epha6	UTSW	16	60205732	missense	possibly damaging	0.89
R1764:Epha6	UTSW	16	59775728	missense	probably null	1.00
R1836:Epha6	UTSW	16	60205745	missense	probably damaging	1.00
R2061:Epha6	UTSW	16	59655797	missense	probably damaging	1.00
R2125:Epha6	UTSW	16	59682688	missense	probably damaging	1.00
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R2867:Epha6	UTSW	16	59960296	splice site	probably null
R3760:Epha6	UTSW	16	60220984	missense	possibly damaging	0.70
R4305:Epha6	UTSW	16	60526520	splice site	probably null
R4613:Epha6	UTSW	16	59666597	missense	possibly damaging	0.80
R4818:Epha6	UTSW	16	59654063	missense	probably damaging	0.99
R4832:Epha6	UTSW	16	59960413	missense	probably damaging	0.98
R4895:Epha6	UTSW	16	59666555	missense	probably benign	0.08
R5014:Epha6	UTSW	16	59666579	missense	probably benign	0.00
R5316:Epha6	UTSW	16	59954720	missense	probably damaging	0.99
R5403:Epha6	UTSW	16	59775570	missense	probably damaging	1.00
R5417:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5418:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R5678:Epha6	UTSW	16	59818979	missense	probably damaging	1.00
R5775:Epha6	UTSW	16	59818994	missense	possibly damaging	0.92
R5808:Epha6	UTSW	16	59682742	missense	probably damaging	1.00
R6076:Epha6	UTSW	16	60205710	missense	probably damaging	1.00
R6146:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6212:Epha6	UTSW	16	60425356	missense	possibly damaging	0.77
R6242:Epha6	UTSW	16	59682662	missense	probably damaging	1.00
R6503:Epha6	UTSW	16	60205621	missense	possibly damaging	0.61
R6580:Epha6	UTSW	16	59682616	missense	probably damaging	1.00
R6726:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6728:Epha6	UTSW	16	60424835	missense	possibly damaging	0.89
R6798:Epha6	UTSW	16	60605064	missense	possibly damaging	0.53
R6798:Epha6	UTSW	16	60605065	missense	possibly damaging	0.53
R6903:Epha6	UTSW	16	60526462	missense	probably benign	0.00
R6999:Epha6	UTSW	16	60425170	missense	possibly damaging	0.94
R7058:Epha6	UTSW	16	59682650	missense	probably damaging	1.00
R7109:Epha6	UTSW	16	59682668	missense	probably damaging	1.00
R7263:Epha6	UTSW	16	59775665	missense	probably damaging	1.00
R7296:Epha6	UTSW	16	59915838	missense	probably benign	0.00
R7343:Epha6	UTSW	16	59960430	missense	probably damaging	0.98
R7443:Epha6	UTSW	16	59775625	missense	possibly damaging	0.93
R7533:Epha6	UTSW	16	60205562	missense	probably damaging	1.00
R7602:Epha6	UTSW	16	59775568	missense	probably damaging	1.00
R7604:Epha6	UTSW	16	60205772	missense	possibly damaging	0.89
R8321:Epha6	UTSW	16	59915954	missense	probably damaging	1.00
R8414:Epha6	UTSW	16	60005667	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAGAACCCTCGATTTCTTCATACCC -3'
(R):5'- ACTGGATCTCTCGTGATGCTGCAC -3'

Sequencing Primer
(F):5'- GATTTCTTCATACCCTGTACTGC -3'
(R):5'- GATCGACACAATTGCTGCTG -3'

Posted On

2014-04-24