Incidental Mutation 'R1593:Gldc'
ID 175649
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms D030049L12Rik, D19Wsu57e
MMRRC Submission 039630-MU
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1593 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 30098449-30175418 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30113750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 815 (I815N)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: I815N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: I815N

low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
R8887:Gldc UTSW 19 30133756 missense possibly damaging 0.94
R8935:Gldc UTSW 19 30131693 missense probably benign 0.00
R8940:Gldc UTSW 19 30151484 missense probably benign
R9070:Gldc UTSW 19 30103004 missense probably damaging 1.00
R9100:Gldc UTSW 19 30099914 missense possibly damaging 0.81
R9144:Gldc UTSW 19 30137193 missense
R9163:Gldc UTSW 19 30134286 missense probably benign 0.13
R9429:Gldc UTSW 19 30113772 missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agatgaaacagttctgggtgg -3'
Posted On 2014-04-24