Incidental Mutation 'R1593:Gldc'
ID 175649
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 039630-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1593 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30091150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 815 (I815N)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably damaging
Transcript: ENSMUST00000025778
AA Change: I815N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: I815N

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,372,581 (GRCm39) I902N possibly damaging Het
Acsl6 A G 11: 54,214,134 (GRCm39) D88G probably damaging Het
Adam1a A C 5: 121,657,706 (GRCm39) I529S probably benign Het
Ap3b1 T C 13: 94,638,435 (GRCm39) V838A unknown Het
Arrdc2 T C 8: 71,289,764 (GRCm39) Y280C probably damaging Het
Atg10 T C 13: 91,302,380 (GRCm39) T53A probably benign Het
Ccdc136 T C 6: 29,415,583 (GRCm39) S699P probably damaging Het
Cdc23 C A 18: 34,769,379 (GRCm39) V462L possibly damaging Het
Clcn6 C T 4: 148,099,051 (GRCm39) A431T probably benign Het
Cntn6 T G 6: 104,809,541 (GRCm39) H525Q possibly damaging Het
Ctr9 T C 7: 110,642,060 (GRCm39) F296S possibly damaging Het
Ctsq T A 13: 61,183,986 (GRCm39) probably null Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Epha6 A T 16: 60,245,267 (GRCm39) F311I probably damaging Het
Esrrg A T 1: 187,798,582 (GRCm39) T150S possibly damaging Het
Exoc2 C A 13: 31,040,744 (GRCm39) R758L possibly damaging Het
Exosc7 G C 9: 122,961,058 (GRCm39) V242L probably benign Het
Fcho2 T C 13: 98,921,315 (GRCm39) D190G possibly damaging Het
Fgd6 T C 10: 93,880,894 (GRCm39) S583P probably damaging Het
Frmd4a A G 2: 4,477,999 (GRCm39) Y60C probably damaging Het
Grm2 A T 9: 106,528,113 (GRCm39) L257Q probably damaging Het
Hectd3 C A 4: 116,854,217 (GRCm39) T289K possibly damaging Het
Itgb4 T C 11: 115,871,817 (GRCm39) V207A probably damaging Het
Lamb3 A G 1: 193,013,104 (GRCm39) E443G probably damaging Het
Meis2 T A 2: 115,830,745 (GRCm39) D256V probably damaging Het
Muc4 A G 16: 32,754,686 (GRCm38) N1520S probably benign Het
Nckap1l A G 15: 103,387,281 (GRCm39) R719G probably null Het
Or6c210 A T 10: 129,496,094 (GRCm39) R140* probably null Het
Pabpc6 A T 17: 9,886,742 (GRCm39) M603K probably damaging Het
Pcnx2 C A 8: 126,486,012 (GRCm39) R1862L probably benign Het
Pgap6 T A 17: 26,337,381 (GRCm39) I399N possibly damaging Het
Pon2 T C 6: 5,273,003 (GRCm39) D122G probably benign Het
Ppig T A 2: 69,579,425 (GRCm39) W378R unknown Het
Ralgapa1 T A 12: 55,817,488 (GRCm39) E389D probably damaging Het
Rapgef6 TG TGG 11: 54,437,223 (GRCm39) probably null Het
Rarg A G 15: 102,148,376 (GRCm39) F233L probably damaging Het
Rasgrp2 T C 19: 6,453,490 (GRCm39) F90L possibly damaging Het
Rrp12 T A 19: 41,851,680 (GRCm39) H1285L probably benign Het
Slc16a13 C A 11: 70,109,908 (GRCm39) A198S probably benign Het
Spag9 A G 11: 93,988,059 (GRCm39) D441G probably damaging Het
Stxbp5l A G 16: 36,936,414 (GRCm39) F1099S probably damaging Het
Tex19.1 T A 11: 121,038,079 (GRCm39) W146R probably damaging Het
Tmod3 T C 9: 75,418,445 (GRCm39) D197G probably benign Het
Tpp2 A G 1: 44,014,593 (GRCm39) H644R probably benign Het
Trpm2 A G 10: 77,778,910 (GRCm39) V352A possibly damaging Het
Tulp1 T C 17: 28,581,675 (GRCm39) K233E probably damaging Het
Vsir A G 10: 60,193,737 (GRCm39) T67A possibly damaging Het
Wdr49 T C 3: 75,304,248 (GRCm39) N487S probably benign Het
Zbtb20 A G 16: 43,429,786 (GRCm39) N99S probably damaging Het
Zfp583 C T 7: 6,320,008 (GRCm39) G335S probably benign Het
Zgrf1 T A 3: 127,354,675 (GRCm39) V98E possibly damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGTGTACCCAACAGGAAAC -3'
(R):5'- AGTGTCATGTCCCTACCACCATGAG -3'

Sequencing Primer
(F):5'- agatgaaacagttctgggtgg -3'
(R):5'- AGCTCCTAGAGACGGTGG -3'
Posted On 2014-04-24