Incidental Mutation 'R1593:Rrp12'
ID175650
Institutional Source Beutler Lab
Gene Symbol Rrp12
Ensembl Gene ENSMUSG00000035049
Gene Nameribosomal RNA processing 12 homolog (S. cerevisiae)
Synonyms
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R1593 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41862852-41896153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41863241 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1285 (H1285L)
Ref Sequence ENSEMBL: ENSMUSP00000039853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038677]
Predicted Effect probably benign
Transcript: ENSMUST00000038677
AA Change: H1285L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039853
Gene: ENSMUSG00000035049
AA Change: H1285L

DomainStartEndE-ValueType
low complexity region 164 175 N/A INTRINSIC
Pfam:NUC173 473 670 1.2e-72 PFAM
SCOP:d1qbkb_ 711 1087 2e-6 SMART
low complexity region 1157 1184 N/A INTRINSIC
low complexity region 1231 1243 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Rrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Rrp12 APN 19 41887094 missense possibly damaging 0.94
IGL00430:Rrp12 APN 19 41877334 critical splice donor site probably null
IGL00496:Rrp12 APN 19 41878027 critical splice donor site probably null
IGL00953:Rrp12 APN 19 41871792 missense possibly damaging 0.51
IGL01320:Rrp12 APN 19 41877936 missense probably damaging 1.00
IGL01479:Rrp12 APN 19 41865202 missense probably benign 0.05
IGL01939:Rrp12 APN 19 41870895 missense probably damaging 0.99
IGL02147:Rrp12 APN 19 41886181 missense probably damaging 1.00
IGL02255:Rrp12 APN 19 41872971 missense probably damaging 1.00
IGL02756:Rrp12 APN 19 41896061 missense probably benign 0.03
IGL02793:Rrp12 APN 19 41871566 missense probably damaging 1.00
IGL03026:Rrp12 APN 19 41872997 missense probably damaging 1.00
IGL03202:Rrp12 APN 19 41868766 splice site probably null
IGL03393:Rrp12 APN 19 41871793 missense possibly damaging 0.91
R0137:Rrp12 UTSW 19 41873850 missense probably benign
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0522:Rrp12 UTSW 19 41874705 splice site probably benign
R0616:Rrp12 UTSW 19 41892549 missense possibly damaging 0.95
R1509:Rrp12 UTSW 19 41882200 missense probably damaging 1.00
R1537:Rrp12 UTSW 19 41886803 missense probably damaging 0.97
R1635:Rrp12 UTSW 19 41868785 missense probably benign 0.00
R1642:Rrp12 UTSW 19 41871737 missense probably damaging 1.00
R1696:Rrp12 UTSW 19 41873749 missense probably damaging 1.00
R1827:Rrp12 UTSW 19 41880481 missense possibly damaging 0.95
R1844:Rrp12 UTSW 19 41877783 critical splice donor site probably null
R1950:Rrp12 UTSW 19 41892590 missense probably damaging 1.00
R2010:Rrp12 UTSW 19 41872937 missense probably benign
R2115:Rrp12 UTSW 19 41891094 missense probably benign 0.38
R2136:Rrp12 UTSW 19 41892599 missense probably damaging 1.00
R2386:Rrp12 UTSW 19 41871284 missense probably benign 0.41
R3741:Rrp12 UTSW 19 41885728 missense probably damaging 1.00
R4096:Rrp12 UTSW 19 41887148 missense probably benign 0.32
R4292:Rrp12 UTSW 19 41872905 splice site probably null
R4407:Rrp12 UTSW 19 41892551 missense probably damaging 1.00
R4629:Rrp12 UTSW 19 41883516 missense probably benign 0.03
R4698:Rrp12 UTSW 19 41873042 missense probably benign 0.12
R4702:Rrp12 UTSW 19 41871536 missense probably damaging 1.00
R4716:Rrp12 UTSW 19 41877428 missense probably damaging 1.00
R4837:Rrp12 UTSW 19 41877505 splice site probably null
R5282:Rrp12 UTSW 19 41876590 missense probably benign
R5327:Rrp12 UTSW 19 41892596 missense probably damaging 1.00
R5621:Rrp12 UTSW 19 41880417 missense probably benign
R5762:Rrp12 UTSW 19 41880152 missense possibly damaging 0.88
R5947:Rrp12 UTSW 19 41870808 critical splice donor site probably null
R6213:Rrp12 UTSW 19 41868778 missense probably benign
R6407:Rrp12 UTSW 19 41883742 missense probably damaging 0.98
R6980:Rrp12 UTSW 19 41890143 missense probably damaging 0.98
R7179:Rrp12 UTSW 19 41883778 missense probably benign 0.03
R7186:Rrp12 UTSW 19 41871305 critical splice acceptor site probably null
R7194:Rrp12 UTSW 19 41871540 missense probably benign
R7206:Rrp12 UTSW 19 41878039 missense probably damaging 1.00
R7209:Rrp12 UTSW 19 41872949 missense possibly damaging 0.62
R7248:Rrp12 UTSW 19 41883438 missense possibly damaging 0.82
R7976:Rrp12 UTSW 19 41891109 missense probably benign 0.04
R8075:Rrp12 UTSW 19 41863274 missense probably damaging 0.96
R8322:Rrp12 UTSW 19 41880219 missense probably benign 0.09
Z1177:Rrp12 UTSW 19 41865567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCACAGTCATCACTCTGCTCTC -3'
(R):5'- CAGTGACCCGGTCAAGACATACAG -3'

Sequencing Primer
(F):5'- GATGTTGGCAATGTCTCCAAAG -3'
(R):5'- cttgccttcctcagtcttcc -3'
Posted On2014-04-24