Mutagenetix > Incidental Mutation

Incidental Mutation 'R1592:Uggt1'

175651

Institutional Source

Beutler Lab

Gene Symbol

Uggt1

Ensembl Gene

ENSMUSG00000037470

Gene Name

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms

Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik

MMRRC Submission

039629-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.425) question?

Stock #

R1592 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36140027-36244720 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 36202858 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 332 (A332S)

Ref Sequence

ENSEMBL: ENSMUSP00000037930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]

AlphaFold

Q6P5E4

Predicted Effect

probably benign
Transcript: ENSMUST00000046875
AA Change: A332S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: A332S

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:UDP-g_GGTase	44	1222	N/A	PFAM
SCOP:d1ga8a_	1256	1521	3e-45	SMART
Blast:BROMO	1414	1453	3e-17	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172592

Predicted Effect

probably benign
Transcript: ENSMUST00000174142

SMART Domains

Protein: ENSMUSP00000133929
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
Pfam:UDP-g_GGTase	1	52	7.8e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174266

SMART Domains

Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174716

Meta Mutation Damage Score

0.1023

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	T	C	5: 121,645,381	E327G	probably damaging	Het
Acp5	A	T	9: 22,127,851	W189R	probably damaging	Het
Adamts8	T	C	9: 30,943,176	S114P	probably damaging	Het
Alkbh3	A	C	2: 94,008,424		probably null	Het
Ankrd13d	T	C	19: 4,282,891	H27R	probably benign	Het
Aox2	A	G	1: 58,300,694	N382S	probably benign	Het
Aspg	G	A	12: 112,119,972	R220Q	probably benign	Het
Atg16l2	C	A	7: 101,291,986	G403V	probably damaging	Het
Bcat1	G	T	6: 145,010,058	Q299K	probably benign	Het
Cc2d1b	C	T	4: 108,626,671		probably benign	Het
Cdh26	T	C	2: 178,449,891	F81S	probably damaging	Het
Cnbd2	A	G	2: 156,335,402	I222M	probably benign	Het
Ephb3	T	C	16: 21,221,700	V562A	probably damaging	Het
Fam186a	T	C	15: 99,940,318	T2682A	probably benign	Het
Fat2	T	C	11: 55,291,870		probably null	Het
Fat4	A	T	3: 39,007,177	D4303V	probably damaging	Het
Fbln1	T	A	15: 85,231,464	S234T	probably benign	Het
Gldc	G	A	19: 30,160,677		probably benign	Het
Gli1	A	C	10: 127,331,329	V685G	probably damaging	Het
H2-T22	T	C	17: 36,041,577	N152S	probably damaging	Het
Inpp5d	A	T	1: 87,665,532	D118V	possibly damaging	Het
Ints10	A	G	8: 68,802,903	I182V	possibly damaging	Het
Ipcef1	C	T	10: 6,935,182		probably null	Het
Kcnj3	G	T	2: 55,437,886	R229L	probably damaging	Het
Klf11	C	A	12: 24,653,738	D57E	probably damaging	Het
Krt73	G	T	15: 101,802,239	S20*	probably null	Het
Lactbl1	A	G	4: 136,635,876		probably null	Het
Mapk10	T	C	5: 103,038,621	D45G	possibly damaging	Het
Mfrp	G	A	9: 44,103,222	C222Y	probably damaging	Het
Mga	A	T	2: 119,964,666	I2944F	possibly damaging	Het
Msh2	A	G	17: 87,680,013		probably null	Het
Nckap1l	T	A	15: 103,482,180		probably null	Het
Olfr1034	A	G	2: 86,046,989	N169S	probably benign	Het
Pitpnm1	T	A	19: 4,106,964		probably null	Het
Sik2	C	T	9: 50,995,671	V85I	probably damaging	Het
Slc26a7	T	A	4: 14,552,470	E229V	probably benign	Het
Spty2d1	A	T	7: 46,998,889	D97E	possibly damaging	Het
Tcaim	G	A	9: 122,818,773		probably null	Het
Tdrd3	T	A	14: 87,505,886	N417K	probably damaging	Het
Usp53	A	T	3: 122,934,050	L961*	probably null	Het
Vmn1r223	A	T	13: 23,249,667	T144S	possibly damaging	Het
Wdfy1	G	A	1: 79,706,255	R388C	probably damaging	Het
Zfp995	T	A	17: 21,887,340	M1L	probably damaging	Het

Other mutations in Uggt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Uggt1	APN	1	36179552	splice site	probably benign
IGL00817:Uggt1	APN	1	36185932	missense	probably benign	0.03
IGL01395:Uggt1	APN	1	36155077	missense	probably damaging	1.00
IGL01609:Uggt1	APN	1	36182474	missense	probably damaging	1.00
IGL01619:Uggt1	APN	1	36161694	missense	probably damaging	0.99
IGL02077:Uggt1	APN	1	36176794	missense	probably damaging	0.99
IGL02313:Uggt1	APN	1	36184484	missense	probably damaging	0.99
IGL02341:Uggt1	APN	1	36164519	makesense	probably null
IGL02346:Uggt1	APN	1	36179670	missense	probably benign	0.00
IGL02447:Uggt1	APN	1	36150142	missense	probably damaging	1.00
IGL02883:Uggt1	APN	1	36177615	missense	probably benign	0.03
IGL02930:Uggt1	APN	1	36157456	missense	probably benign	0.01
IGL03153:Uggt1	APN	1	36202818	missense	possibly damaging	0.94
IGL03162:Uggt1	APN	1	36207956	missense	probably damaging	1.00
IGL03170:Uggt1	APN	1	36163261	missense	probably damaging	1.00
IGL03266:Uggt1	APN	1	36150048	missense	probably damaging	1.00
K3955:Uggt1	UTSW	1	36162353	missense	probably benign	0.37
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0167:Uggt1	UTSW	1	36170197	critical splice donor site	probably null
R0373:Uggt1	UTSW	1	36179670	missense	probably benign	0.00
R0502:Uggt1	UTSW	1	36159946	missense	probably damaging	1.00
R0546:Uggt1	UTSW	1	36195971	missense	probably benign	0.00
R0610:Uggt1	UTSW	1	36165506	splice site	probably benign
R0671:Uggt1	UTSW	1	36155128	missense	probably damaging	1.00
R0760:Uggt1	UTSW	1	36161724	missense	possibly damaging	0.68
R0825:Uggt1	UTSW	1	36158143	missense	probably benign	0.01
R0827:Uggt1	UTSW	1	36156313	critical splice acceptor site	probably null
R0884:Uggt1	UTSW	1	36175078	missense	probably benign	0.00
R1112:Uggt1	UTSW	1	36173546	missense	possibly damaging	0.54
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1730:Uggt1	UTSW	1	36221261	missense	probably benign	0.05
R1923:Uggt1	UTSW	1	36179613	missense	probably damaging	0.99
R1970:Uggt1	UTSW	1	36151781	missense	probably damaging	1.00
R2086:Uggt1	UTSW	1	36192414	missense	probably null	1.00
R2829:Uggt1	UTSW	1	36162294	missense	probably benign	0.38
R3431:Uggt1	UTSW	1	36210059	nonsense	probably null
R3432:Uggt1	UTSW	1	36210059	nonsense	probably null
R3725:Uggt1	UTSW	1	36182507	nonsense	probably null
R3880:Uggt1	UTSW	1	36176804	intron	probably benign
R4052:Uggt1	UTSW	1	36164489	missense	probably damaging	0.98
R4133:Uggt1	UTSW	1	36158159	missense	probably damaging	1.00
R4489:Uggt1	UTSW	1	36146668	nonsense	probably null
R4570:Uggt1	UTSW	1	36150073	missense	probably damaging	1.00
R4866:Uggt1	UTSW	1	36202855	nonsense	probably null
R4895:Uggt1	UTSW	1	36156264	missense	probably damaging	1.00
R4900:Uggt1	UTSW	1	36202855	nonsense	probably null
R5372:Uggt1	UTSW	1	36244060	splice site	probably benign
R5385:Uggt1	UTSW	1	36184412	missense	probably damaging	1.00
R5652:Uggt1	UTSW	1	36216153	nonsense	probably null
R5694:Uggt1	UTSW	1	36179656	missense	probably damaging	1.00
R5732:Uggt1	UTSW	1	36161771	splice site	probably null
R5893:Uggt1	UTSW	1	36227628	splice site	probably null
R6191:Uggt1	UTSW	1	36162208	missense	probably damaging	0.98
R6247:Uggt1	UTSW	1	36163228	missense	probably damaging	1.00
R6259:Uggt1	UTSW	1	36234916	missense	probably benign	0.00
R6399:Uggt1	UTSW	1	36163366	missense	possibly damaging	0.90
R6439:Uggt1	UTSW	1	36174951	missense	possibly damaging	0.95
R6468:Uggt1	UTSW	1	36173450	missense	probably benign	0.00
R6788:Uggt1	UTSW	1	36230688	missense	probably benign	0.00
R7165:Uggt1	UTSW	1	36155107	missense	probably benign	0.41
R7255:Uggt1	UTSW	1	36146106	missense	probably damaging	1.00
R7273:Uggt1	UTSW	1	36162221	missense	probably damaging	0.99
R7469:Uggt1	UTSW	1	36151733	missense	probably damaging	1.00
R7490:Uggt1	UTSW	1	36164508	missense	probably benign	0.01
R7570:Uggt1	UTSW	1	36185838	missense	probably benign	0.09
R7612:Uggt1	UTSW	1	36163235	missense	probably damaging	0.99
R7759:Uggt1	UTSW	1	36146725	missense	possibly damaging	0.81
R7792:Uggt1	UTSW	1	36207984	missense	probably damaging	1.00
R7816:Uggt1	UTSW	1	36163315	missense	possibly damaging	0.95
R7858:Uggt1	UTSW	1	36156258	missense	probably damaging	1.00
R7887:Uggt1	UTSW	1	36208034	missense	probably damaging	0.99
R8040:Uggt1	UTSW	1	36211473	missense	possibly damaging	0.70
R8093:Uggt1	UTSW	1	36227485	missense	probably damaging	1.00
R8245:Uggt1	UTSW	1	36165564	missense	probably damaging	1.00
R8338:Uggt1	UTSW	1	36227521	missense	probably damaging	1.00
R8353:Uggt1	UTSW	1	36170296	critical splice acceptor site	probably null
R8442:Uggt1	UTSW	1	36173487	missense	probably damaging	0.99
R8519:Uggt1	UTSW	1	36176643	splice site	probably null
R8529:Uggt1	UTSW	1	36184432	missense	possibly damaging	0.85
R8730:Uggt1	UTSW	1	36197543	critical splice donor site	probably null
R8917:Uggt1	UTSW	1	36146654	missense
R8947:Uggt1	UTSW	1	36158148	missense	probably benign	0.12
R9240:Uggt1	UTSW	1	36182615	missense	possibly damaging	0.50
R9248:Uggt1	UTSW	1	36210022	missense	possibly damaging	0.80
R9401:Uggt1	UTSW	1	36216131	critical splice donor site	probably null
R9414:Uggt1	UTSW	1	36184426	missense	probably benign	0.01
R9416:Uggt1	UTSW	1	36164522	missense
R9441:Uggt1	UTSW	1	36221225	missense	probably benign	0.02
R9489:Uggt1	UTSW	1	36234805	critical splice donor site	probably null
R9563:Uggt1	UTSW	1	36165546	missense	possibly damaging	0.60
R9605:Uggt1	UTSW	1	36234805	critical splice donor site	probably null
X0022:Uggt1	UTSW	1	36165555	missense	possibly damaging	0.67
Z1088:Uggt1	UTSW	1	36174191	missense	probably damaging	1.00
Z1176:Uggt1	UTSW	1	36161695	missense	probably damaging	1.00
Z1177:Uggt1	UTSW	1	36155073	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTGCCAAGAGCATCTAAATCCC -3'
(R):5'- TGAACGAGGTCTGAGCTAAGCCTG -3'

Sequencing Primer
(F):5'- GATCGCAACAGTACTTACAAATAGG -3'
(R):5'- TGAGCTAAGCCTGGGACAC -3'

Posted On

2014-04-24