Incidental Mutation 'R1592:Uggt1'
ID175651
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene NameUDP-glucose glycoprotein glucosyltransferase 1
SynonymsUgcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik
MMRRC Submission 039629-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R1592 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36140027-36244720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36202858 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 332 (A332S)
Ref Sequence ENSEMBL: ENSMUSP00000037930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]
Predicted Effect probably benign
Transcript: ENSMUST00000046875
AA Change: A332S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: A332S

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172592
Predicted Effect probably benign
Transcript: ENSMUST00000174142
SMART Domains Protein: ENSMUSP00000133929
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 1 52 7.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174266
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174716
Meta Mutation Damage Score 0.1023 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,645,381 E327G probably damaging Het
Acp5 A T 9: 22,127,851 W189R probably damaging Het
Adamts8 T C 9: 30,943,176 S114P probably damaging Het
Alkbh3 A C 2: 94,008,424 probably null Het
Ankrd13d T C 19: 4,282,891 H27R probably benign Het
Aox2 A G 1: 58,300,694 N382S probably benign Het
Aspg G A 12: 112,119,972 R220Q probably benign Het
Atg16l2 C A 7: 101,291,986 G403V probably damaging Het
Bcat1 G T 6: 145,010,058 Q299K probably benign Het
Cc2d1b C T 4: 108,626,671 probably benign Het
Cdh26 T C 2: 178,449,891 F81S probably damaging Het
Cnbd2 A G 2: 156,335,402 I222M probably benign Het
Ephb3 T C 16: 21,221,700 V562A probably damaging Het
Fam186a T C 15: 99,940,318 T2682A probably benign Het
Fat2 T C 11: 55,291,870 probably null Het
Fat4 A T 3: 39,007,177 D4303V probably damaging Het
Fbln1 T A 15: 85,231,464 S234T probably benign Het
Gldc G A 19: 30,160,677 probably benign Het
Gli1 A C 10: 127,331,329 V685G probably damaging Het
H2-T22 T C 17: 36,041,577 N152S probably damaging Het
Inpp5d A T 1: 87,665,532 D118V possibly damaging Het
Ints10 A G 8: 68,802,903 I182V possibly damaging Het
Ipcef1 C T 10: 6,935,182 probably null Het
Kcnj3 G T 2: 55,437,886 R229L probably damaging Het
Klf11 C A 12: 24,653,738 D57E probably damaging Het
Krt73 G T 15: 101,802,239 S20* probably null Het
Lactbl1 A G 4: 136,635,876 probably null Het
Mapk10 T C 5: 103,038,621 D45G possibly damaging Het
Mfrp G A 9: 44,103,222 C222Y probably damaging Het
Mga A T 2: 119,964,666 I2944F possibly damaging Het
Msh2 A G 17: 87,680,013 probably null Het
Nckap1l T A 15: 103,482,180 probably null Het
Olfr1034 A G 2: 86,046,989 N169S probably benign Het
Pitpnm1 T A 19: 4,106,964 probably null Het
Sik2 C T 9: 50,995,671 V85I probably damaging Het
Slc26a7 T A 4: 14,552,470 E229V probably benign Het
Spty2d1 A T 7: 46,998,889 D97E possibly damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Usp53 A T 3: 122,934,050 L961* probably null Het
Vmn1r223 A T 13: 23,249,667 T144S possibly damaging Het
Wdfy1 G A 1: 79,706,255 R388C probably damaging Het
Zfp995 T A 17: 21,887,340 M1L probably damaging Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36179552 splice site probably benign
IGL00817:Uggt1 APN 1 36185932 missense probably benign 0.03
IGL01395:Uggt1 APN 1 36155077 missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36182474 missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36161694 missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36176794 missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36184484 missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36164519 makesense probably null
IGL02346:Uggt1 APN 1 36179670 missense probably benign 0.00
IGL02447:Uggt1 APN 1 36150142 missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36177615 missense probably benign 0.03
IGL02930:Uggt1 APN 1 36157456 missense probably benign 0.01
IGL03153:Uggt1 APN 1 36202818 missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36207956 missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36163261 missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36150048 missense probably damaging 1.00
K3955:Uggt1 UTSW 1 36162353 missense probably benign 0.37
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0167:Uggt1 UTSW 1 36170197 critical splice donor site probably null
R0373:Uggt1 UTSW 1 36179670 missense probably benign 0.00
R0502:Uggt1 UTSW 1 36159946 missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36195971 missense probably benign 0.00
R0610:Uggt1 UTSW 1 36165506 splice site probably benign
R0671:Uggt1 UTSW 1 36155128 missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36161724 missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36158143 missense probably benign 0.01
R0827:Uggt1 UTSW 1 36156313 critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36175078 missense probably benign 0.00
R1112:Uggt1 UTSW 1 36173546 missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1730:Uggt1 UTSW 1 36221261 missense probably benign 0.05
R1923:Uggt1 UTSW 1 36179613 missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36151781 missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36192414 missense probably null 1.00
R2829:Uggt1 UTSW 1 36162294 missense probably benign 0.38
R3431:Uggt1 UTSW 1 36210059 nonsense probably null
R3432:Uggt1 UTSW 1 36210059 nonsense probably null
R3725:Uggt1 UTSW 1 36182507 nonsense probably null
R3880:Uggt1 UTSW 1 36176804 intron probably benign
R4052:Uggt1 UTSW 1 36164489 missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36158159 missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36146668 nonsense probably null
R4570:Uggt1 UTSW 1 36150073 missense probably damaging 1.00
R4866:Uggt1 UTSW 1 36202855 nonsense probably null
R4895:Uggt1 UTSW 1 36156264 missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36202855 nonsense probably null
R5372:Uggt1 UTSW 1 36244060 splice site probably benign
R5385:Uggt1 UTSW 1 36184412 missense probably damaging 1.00
R5652:Uggt1 UTSW 1 36216153 nonsense probably null
R5694:Uggt1 UTSW 1 36179656 missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36161771 splice site probably null
R5893:Uggt1 UTSW 1 36227628 splice site probably null
R6191:Uggt1 UTSW 1 36162208 missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36163228 missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36234916 missense probably benign 0.00
R6399:Uggt1 UTSW 1 36163366 missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36174951 missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36173450 missense probably benign 0.00
R6788:Uggt1 UTSW 1 36230688 missense probably benign 0.00
R7165:Uggt1 UTSW 1 36155107 missense probably benign 0.41
R7255:Uggt1 UTSW 1 36146106 missense probably damaging 1.00
R7273:Uggt1 UTSW 1 36162221 missense probably damaging 0.99
R7469:Uggt1 UTSW 1 36151733 missense probably damaging 1.00
R7490:Uggt1 UTSW 1 36164508 missense probably benign 0.01
R7570:Uggt1 UTSW 1 36185838 missense probably benign 0.09
R7612:Uggt1 UTSW 1 36163235 missense probably damaging 0.99
R7759:Uggt1 UTSW 1 36146725 missense possibly damaging 0.81
R7792:Uggt1 UTSW 1 36207984 missense probably damaging 1.00
R7816:Uggt1 UTSW 1 36163315 missense possibly damaging 0.95
R7858:Uggt1 UTSW 1 36156258 missense probably damaging 1.00
R7887:Uggt1 UTSW 1 36208034 missense probably damaging 0.99
R7941:Uggt1 UTSW 1 36156258 missense probably damaging 1.00
R7970:Uggt1 UTSW 1 36208034 missense probably damaging 0.99
R8040:Uggt1 UTSW 1 36211473 missense possibly damaging 0.70
X0022:Uggt1 UTSW 1 36165555 missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36174191 missense probably damaging 1.00
Z1176:Uggt1 UTSW 1 36161695 missense probably damaging 1.00
Z1177:Uggt1 UTSW 1 36155073 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGCCAAGAGCATCTAAATCCC -3'
(R):5'- TGAACGAGGTCTGAGCTAAGCCTG -3'

Sequencing Primer
(F):5'- GATCGCAACAGTACTTACAAATAGG -3'
(R):5'- TGAGCTAAGCCTGGGACAC -3'
Posted On2014-04-24