Mutagenetix > Incidental Mutation

Incidental Mutation 'R1592:Aox2'

175652

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

MMRRC Submission

039629-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R1592 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58300694 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 382 (N382S)

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably benign
Transcript: ENSMUST00000114366
AA Change: N382S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: N382S

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161126

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	T	C	5: 121,645,381	E327G	probably damaging	Het
Acp5	A	T	9: 22,127,851	W189R	probably damaging	Het
Adamts8	T	C	9: 30,943,176	S114P	probably damaging	Het
Alkbh3	A	C	2: 94,008,424		probably null	Het
Ankrd13d	T	C	19: 4,282,891	H27R	probably benign	Het
Aspg	G	A	12: 112,119,972	R220Q	probably benign	Het
Atg16l2	C	A	7: 101,291,986	G403V	probably damaging	Het
Bcat1	G	T	6: 145,010,058	Q299K	probably benign	Het
Cc2d1b	C	T	4: 108,626,671		probably benign	Het
Cdh26	T	C	2: 178,449,891	F81S	probably damaging	Het
Cnbd2	A	G	2: 156,335,402	I222M	probably benign	Het
Ephb3	T	C	16: 21,221,700	V562A	probably damaging	Het
Fam186a	T	C	15: 99,940,318	T2682A	probably benign	Het
Fat2	T	C	11: 55,291,870		probably null	Het
Fat4	A	T	3: 39,007,177	D4303V	probably damaging	Het
Fbln1	T	A	15: 85,231,464	S234T	probably benign	Het
Gldc	G	A	19: 30,160,677		probably benign	Het
Gli1	A	C	10: 127,331,329	V685G	probably damaging	Het
H2-T22	T	C	17: 36,041,577	N152S	probably damaging	Het
Inpp5d	A	T	1: 87,665,532	D118V	possibly damaging	Het
Ints10	A	G	8: 68,802,903	I182V	possibly damaging	Het
Ipcef1	C	T	10: 6,935,182		probably null	Het
Kcnj3	G	T	2: 55,437,886	R229L	probably damaging	Het
Klf11	C	A	12: 24,653,738	D57E	probably damaging	Het
Krt73	G	T	15: 101,802,239	S20*	probably null	Het
Lactbl1	A	G	4: 136,635,876		probably null	Het
Mapk10	T	C	5: 103,038,621	D45G	possibly damaging	Het
Mfrp	G	A	9: 44,103,222	C222Y	probably damaging	Het
Mga	A	T	2: 119,964,666	I2944F	possibly damaging	Het
Msh2	A	G	17: 87,680,013		probably null	Het
Nckap1l	T	A	15: 103,482,180		probably null	Het
Olfr1034	A	G	2: 86,046,989	N169S	probably benign	Het
Pitpnm1	T	A	19: 4,106,964		probably null	Het
Sik2	C	T	9: 50,995,671	V85I	probably damaging	Het
Slc26a7	T	A	4: 14,552,470	E229V	probably benign	Het
Spty2d1	A	T	7: 46,998,889	D97E	possibly damaging	Het
Tcaim	G	A	9: 122,818,773		probably null	Het
Tdrd3	T	A	14: 87,505,886	N417K	probably damaging	Het
Uggt1	C	A	1: 36,202,858	A332S	probably benign	Het
Usp53	A	T	3: 122,934,050	L961*	probably null	Het
Vmn1r223	A	T	13: 23,249,667	T144S	possibly damaging	Het
Wdfy1	G	A	1: 79,706,255	R388C	probably damaging	Het
Zfp995	T	A	17: 21,887,340	M1L	probably damaging	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
PIT4362001:Aox2	UTSW	1	58282680	missense	probably damaging	1.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0734:Aox2	UTSW	1	58305341	missense	probably benign	0.22
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R0961:Aox2	UTSW	1	58310071	missense	probably benign	0.00
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1747:Aox2	UTSW	1	58339592	missense	probably benign	0.01
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4214:Aox2	UTSW	1	58307444	critical splice donor site	probably null
R4249:Aox2	UTSW	1	58299819	missense	probably benign	0.01
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6789:Aox2	UTSW	1	58304485	missense	probably benign	0.01
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8165:Aox2	UTSW	1	58308929	missense	probably benign	0.08
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9101:Aox2	UTSW	1	58332637	missense	probably benign	0.03
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- ACGAGAGCATAAGAGATGCCTCCC -3'
(R):5'- AGAAAGCACCTCTGCCCATTGG -3'

Sequencing Primer
(F):5'- TACATGGACCCCTGAGGACAG -3'
(R):5'- TGGTGAACTGAGTCTGTGAC -3'

Posted On

2014-04-24