Incidental Mutation 'R1592:Aox2'
ID 175652
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
MMRRC Submission 039629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R1592 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58300694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 382 (N382S)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably benign
Transcript: ENSMUST00000114366
AA Change: N382S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: N382S

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161126
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,645,381 E327G probably damaging Het
Acp5 A T 9: 22,127,851 W189R probably damaging Het
Adamts8 T C 9: 30,943,176 S114P probably damaging Het
Alkbh3 A C 2: 94,008,424 probably null Het
Ankrd13d T C 19: 4,282,891 H27R probably benign Het
Aspg G A 12: 112,119,972 R220Q probably benign Het
Atg16l2 C A 7: 101,291,986 G403V probably damaging Het
Bcat1 G T 6: 145,010,058 Q299K probably benign Het
Cc2d1b C T 4: 108,626,671 probably benign Het
Cdh26 T C 2: 178,449,891 F81S probably damaging Het
Cnbd2 A G 2: 156,335,402 I222M probably benign Het
Ephb3 T C 16: 21,221,700 V562A probably damaging Het
Fam186a T C 15: 99,940,318 T2682A probably benign Het
Fat2 T C 11: 55,291,870 probably null Het
Fat4 A T 3: 39,007,177 D4303V probably damaging Het
Fbln1 T A 15: 85,231,464 S234T probably benign Het
Gldc G A 19: 30,160,677 probably benign Het
Gli1 A C 10: 127,331,329 V685G probably damaging Het
H2-T22 T C 17: 36,041,577 N152S probably damaging Het
Inpp5d A T 1: 87,665,532 D118V possibly damaging Het
Ints10 A G 8: 68,802,903 I182V possibly damaging Het
Ipcef1 C T 10: 6,935,182 probably null Het
Kcnj3 G T 2: 55,437,886 R229L probably damaging Het
Klf11 C A 12: 24,653,738 D57E probably damaging Het
Krt73 G T 15: 101,802,239 S20* probably null Het
Lactbl1 A G 4: 136,635,876 probably null Het
Mapk10 T C 5: 103,038,621 D45G possibly damaging Het
Mfrp G A 9: 44,103,222 C222Y probably damaging Het
Mga A T 2: 119,964,666 I2944F possibly damaging Het
Msh2 A G 17: 87,680,013 probably null Het
Nckap1l T A 15: 103,482,180 probably null Het
Olfr1034 A G 2: 86,046,989 N169S probably benign Het
Pitpnm1 T A 19: 4,106,964 probably null Het
Sik2 C T 9: 50,995,671 V85I probably damaging Het
Slc26a7 T A 4: 14,552,470 E229V probably benign Het
Spty2d1 A T 7: 46,998,889 D97E possibly damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Uggt1 C A 1: 36,202,858 A332S probably benign Het
Usp53 A T 3: 122,934,050 L961* probably null Het
Vmn1r223 A T 13: 23,249,667 T144S possibly damaging Het
Wdfy1 G A 1: 79,706,255 R388C probably damaging Het
Zfp995 T A 17: 21,887,340 M1L probably damaging Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACGAGAGCATAAGAGATGCCTCCC -3'
(R):5'- AGAAAGCACCTCTGCCCATTGG -3'

Sequencing Primer
(F):5'- TACATGGACCCCTGAGGACAG -3'
(R):5'- TGGTGAACTGAGTCTGTGAC -3'
Posted On 2014-04-24