Incidental Mutation 'R1592:Alkbh3'
ID175658
Institutional Source Beutler Lab
Gene Symbol Alkbh3
Ensembl Gene ENSMUSG00000040174
Gene NamealkB homolog 3, alpha-ketoglutarate-dependent dioxygenase
SynonymsmABH3, 1700108H04Rik, 1810020C19Rik, Abh3
MMRRC Submission 039629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R1592 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location93980550-94010807 bp(-) (GRCm38)
Type of Mutationintron (19 bp from exon)
DNA Base Change (assembly) A to C at 94008424 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040005] [ENSMUST00000111240] [ENSMUST00000126378]
Predicted Effect probably null
Transcript: ENSMUST00000040005
SMART Domains Protein: ENSMUSP00000038721
Gene: ENSMUSG00000040174

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 89 275 2e-34 PFAM
Pfam:2OG-FeII_Oxy 172 277 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111240
AA Change: L33R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106871
Gene: ENSMUSG00000040174
AA Change: L33R

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 276 3.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126378
AA Change: L33R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000122043
Gene: ENSMUSG00000040174
AA Change: L33R

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 202 8.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156763
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 (MIM 610602) and ALKBH3 are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal lifespan and are phenotypically indistinguishable from control littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,645,381 E327G probably damaging Het
Acp5 A T 9: 22,127,851 W189R probably damaging Het
Adamts8 T C 9: 30,943,176 S114P probably damaging Het
Ankrd13d T C 19: 4,282,891 H27R probably benign Het
Aox2 A G 1: 58,300,694 N382S probably benign Het
Aspg G A 12: 112,119,972 R220Q probably benign Het
Atg16l2 C A 7: 101,291,986 G403V probably damaging Het
Bcat1 G T 6: 145,010,058 Q299K probably benign Het
Cc2d1b C T 4: 108,626,671 probably benign Het
Cdh26 T C 2: 178,449,891 F81S probably damaging Het
Cnbd2 A G 2: 156,335,402 I222M probably benign Het
Ephb3 T C 16: 21,221,700 V562A probably damaging Het
Fam186a T C 15: 99,940,318 T2682A probably benign Het
Fat2 T C 11: 55,291,870 probably null Het
Fat4 A T 3: 39,007,177 D4303V probably damaging Het
Fbln1 T A 15: 85,231,464 S234T probably benign Het
Gldc G A 19: 30,160,677 probably benign Het
Gli1 A C 10: 127,331,329 V685G probably damaging Het
H2-T22 T C 17: 36,041,577 N152S probably damaging Het
Inpp5d A T 1: 87,665,532 D118V possibly damaging Het
Ints10 A G 8: 68,802,903 I182V possibly damaging Het
Ipcef1 C T 10: 6,935,182 probably null Het
Kcnj3 G T 2: 55,437,886 R229L probably damaging Het
Klf11 C A 12: 24,653,738 D57E probably damaging Het
Krt73 G T 15: 101,802,239 S20* probably null Het
Lactbl1 A G 4: 136,635,876 probably null Het
Mapk10 T C 5: 103,038,621 D45G possibly damaging Het
Mfrp G A 9: 44,103,222 C222Y probably damaging Het
Mga A T 2: 119,964,666 I2944F possibly damaging Het
Msh2 A G 17: 87,680,013 probably null Het
Nckap1l T A 15: 103,482,180 probably null Het
Olfr1034 A G 2: 86,046,989 N169S probably benign Het
Pitpnm1 T A 19: 4,106,964 probably null Het
Sik2 C T 9: 50,995,671 V85I probably damaging Het
Slc26a7 T A 4: 14,552,470 E229V probably benign Het
Spty2d1 A T 7: 46,998,889 D97E possibly damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Uggt1 C A 1: 36,202,858 A332S probably benign Het
Usp53 A T 3: 122,934,050 L961* probably null Het
Vmn1r223 A T 13: 23,249,667 T144S possibly damaging Het
Wdfy1 G A 1: 79,706,255 R388C probably damaging Het
Zfp995 T A 17: 21,887,340 M1L probably damaging Het
Other mutations in Alkbh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Alkbh3 APN 2 94003051 critical splice donor site probably null
IGL01940:Alkbh3 APN 2 93981595 missense probably damaging 0.98
IGL02554:Alkbh3 APN 2 93996347 missense probably damaging 1.00
IGL02638:Alkbh3 APN 2 94008113 missense probably benign 0.02
IGL02640:Alkbh3 APN 2 93996361 missense possibly damaging 0.90
R0409:Alkbh3 UTSW 2 94001448 missense possibly damaging 0.84
R0437:Alkbh3 UTSW 2 93981569 missense probably damaging 1.00
R1456:Alkbh3 UTSW 2 94001419 splice site probably null
R2359:Alkbh3 UTSW 2 94008113 missense probably benign 0.01
R3109:Alkbh3 UTSW 2 94004763 missense probably damaging 1.00
R4297:Alkbh3 UTSW 2 94008124 missense probably benign
R5562:Alkbh3 UTSW 2 93996379 unclassified probably null
R6216:Alkbh3 UTSW 2 94008536 start gained probably benign
R7088:Alkbh3 UTSW 2 94004752 missense possibly damaging 0.55
R7711:Alkbh3 UTSW 2 94008092 missense probably benign
R8014:Alkbh3 UTSW 2 94001513 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAACAAGAGCCGATAAGAACTGCG -3'
(R):5'- ACTTACCCTTTACTAGGCCAGGCAC -3'

Sequencing Primer
(F):5'- CTGCGTGAAGATGACTTATGACC -3'
(R):5'- GTTTTGAAAACAGGTAGCCATCCC -3'
Posted On2014-04-24