Mutagenetix > Incidental Mutation

Incidental Mutation 'R1592:Acad10'

175670

Institutional Source

Beutler Lab

Gene Symbol

Acad10

Ensembl Gene

ENSMUSG00000029456

Gene Name

acyl-Coenzyme A dehydrogenase family, member 10

Synonyms

2410021P16Rik

MMRRC Submission

039629-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1592 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121621026-121660514 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121645381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 327 (E327G)

Ref Sequence

ENSEMBL: ENSMUSP00000107400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]

AlphaFold

Q8K370

Predicted Effect

probably damaging
Transcript: ENSMUST00000031412
AA Change: E327G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: E327G

Domain	Start	End	E-Value	Type
Pfam:HAD_2	45	231	1.6e-14	PFAM
Pfam:Hydrolase	88	225	5e-8	PFAM
Pfam:APH	287	531	1.8e-52	PFAM
Pfam:Acyl-CoA_dh_N	660	787	1.7e-15	PFAM
Pfam:Acyl-CoA_dh_M	791	892	2.7e-20	PFAM
Pfam:Acyl-CoA_dh_1	904	1055	1.1e-35	PFAM
Pfam:Acyl-CoA_dh_2	919	1037	6.4e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111770
AA Change: E327G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: E327G

Domain	Start	End	E-Value	Type
Pfam:HAD_2	45	231	2.3e-14	PFAM
Pfam:APH	287	523	3.2e-50	PFAM
Pfam:EcKinase	390	504	5.2e-8	PFAM
Pfam:Acyl-CoA_dh_N	660	787	3.4e-14	PFAM
Pfam:Acyl-CoA_dh_M	791	845	2.7e-13	PFAM
Pfam:Acyl-CoA_dh_1	904	1055	9.4e-36	PFAM
Pfam:Acyl-CoA_dh_2	919	1037	1.6e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133775

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137231

Meta Mutation Damage Score

0.4598

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp5	A	T	9: 22,127,851	W189R	probably damaging	Het
Adamts8	T	C	9: 30,943,176	S114P	probably damaging	Het
Alkbh3	A	C	2: 94,008,424		probably null	Het
Ankrd13d	T	C	19: 4,282,891	H27R	probably benign	Het
Aox2	A	G	1: 58,300,694	N382S	probably benign	Het
Aspg	G	A	12: 112,119,972	R220Q	probably benign	Het
Atg16l2	C	A	7: 101,291,986	G403V	probably damaging	Het
Bcat1	G	T	6: 145,010,058	Q299K	probably benign	Het
Cc2d1b	C	T	4: 108,626,671		probably benign	Het
Cdh26	T	C	2: 178,449,891	F81S	probably damaging	Het
Cnbd2	A	G	2: 156,335,402	I222M	probably benign	Het
Ephb3	T	C	16: 21,221,700	V562A	probably damaging	Het
Fam186a	T	C	15: 99,940,318	T2682A	probably benign	Het
Fat2	T	C	11: 55,291,870		probably null	Het
Fat4	A	T	3: 39,007,177	D4303V	probably damaging	Het
Fbln1	T	A	15: 85,231,464	S234T	probably benign	Het
Gldc	G	A	19: 30,160,677		probably benign	Het
Gli1	A	C	10: 127,331,329	V685G	probably damaging	Het
H2-T22	T	C	17: 36,041,577	N152S	probably damaging	Het
Inpp5d	A	T	1: 87,665,532	D118V	possibly damaging	Het
Ints10	A	G	8: 68,802,903	I182V	possibly damaging	Het
Ipcef1	C	T	10: 6,935,182		probably null	Het
Kcnj3	G	T	2: 55,437,886	R229L	probably damaging	Het
Klf11	C	A	12: 24,653,738	D57E	probably damaging	Het
Krt73	G	T	15: 101,802,239	S20*	probably null	Het
Lactbl1	A	G	4: 136,635,876		probably null	Het
Mapk10	T	C	5: 103,038,621	D45G	possibly damaging	Het
Mfrp	G	A	9: 44,103,222	C222Y	probably damaging	Het
Mga	A	T	2: 119,964,666	I2944F	possibly damaging	Het
Msh2	A	G	17: 87,680,013		probably null	Het
Nckap1l	T	A	15: 103,482,180		probably null	Het
Olfr1034	A	G	2: 86,046,989	N169S	probably benign	Het
Pitpnm1	T	A	19: 4,106,964		probably null	Het
Sik2	C	T	9: 50,995,671	V85I	probably damaging	Het
Slc26a7	T	A	4: 14,552,470	E229V	probably benign	Het
Spty2d1	A	T	7: 46,998,889	D97E	possibly damaging	Het
Tcaim	G	A	9: 122,818,773		probably null	Het
Tdrd3	T	A	14: 87,505,886	N417K	probably damaging	Het
Uggt1	C	A	1: 36,202,858	A332S	probably benign	Het
Usp53	A	T	3: 122,934,050	L961*	probably null	Het
Vmn1r223	A	T	13: 23,249,667	T144S	possibly damaging	Het
Wdfy1	G	A	1: 79,706,255	R388C	probably damaging	Het
Zfp995	T	A	17: 21,887,340	M1L	probably damaging	Het

Other mutations in Acad10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02379:Acad10	APN	5	121622043	missense	probably damaging	1.00
IGL02469:Acad10	APN	5	121645459	missense	probably damaging	1.00
IGL02526:Acad10	APN	5	121646860	missense	probably damaging	0.99
IGL02623:Acad10	APN	5	121629930	missense	possibly damaging	0.94
IGL02643:Acad10	APN	5	121631570	missense	probably benign
IGL02685:Acad10	APN	5	121632609	missense	probably benign
IGL03139:Acad10	APN	5	121626082	missense	probably benign
IGL03267:Acad10	APN	5	121637349	missense	probably benign	0.34
P0026:Acad10	UTSW	5	121637352	missense	probably damaging	1.00
R0099:Acad10	UTSW	5	121621290	missense	probably damaging	1.00
R0453:Acad10	UTSW	5	121627382	nonsense	probably null
R1051:Acad10	UTSW	5	121626080	missense	probably damaging	0.97
R1052:Acad10	UTSW	5	121649541	missense	possibly damaging	0.65
R1116:Acad10	UTSW	5	121630751	missense	probably damaging	1.00
R1548:Acad10	UTSW	5	121626040	splice site	probably benign
R1548:Acad10	UTSW	5	121626041	splice site	probably benign
R1571:Acad10	UTSW	5	121621348	missense	probably damaging	0.99
R1741:Acad10	UTSW	5	121647836	missense	probably damaging	1.00
R1789:Acad10	UTSW	5	121631393	missense	possibly damaging	0.67
R1974:Acad10	UTSW	5	121626185	missense	possibly damaging	0.95
R2007:Acad10	UTSW	5	121634751	missense	probably damaging	1.00
R2085:Acad10	UTSW	5	121649460	missense	possibly damaging	0.79
R2351:Acad10	UTSW	5	121629927	missense	probably benign	0.23
R2511:Acad10	UTSW	5	121631567	missense	probably benign	0.02
R2570:Acad10	UTSW	5	121630204	missense	probably damaging	1.00
R3824:Acad10	UTSW	5	121622818	missense	probably benign
R3846:Acad10	UTSW	5	121634686	missense	probably benign	0.19
R4106:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R4107:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R4108:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R5569:Acad10	UTSW	5	121626080	missense	probably damaging	0.97
R5704:Acad10	UTSW	5	121631543	missense	probably benign	0.03
R5845:Acad10	UTSW	5	121626083	missense	probably benign
R5990:Acad10	UTSW	5	121645405	missense	probably damaging	1.00
R6019:Acad10	UTSW	5	121634801	missense	possibly damaging	0.88
R6145:Acad10	UTSW	5	121622033	missense	probably damaging	0.97
R6384:Acad10	UTSW	5	121652003	missense	probably benign	0.43
R6491:Acad10	UTSW	5	121630157	missense	probably damaging	1.00
R6608:Acad10	UTSW	5	121632492	missense	probably benign	0.02
R6941:Acad10	UTSW	5	121649357	missense	probably damaging	1.00
R7221:Acad10	UTSW	5	121630210	missense	probably damaging	1.00
R7283:Acad10	UTSW	5	121649475	missense	possibly damaging	0.79
R7355:Acad10	UTSW	5	121630717	nonsense	probably null
R7483:Acad10	UTSW	5	121656012	critical splice donor site	probably null
R7553:Acad10	UTSW	5	121639255	missense	probably damaging	1.00
R7721:Acad10	UTSW	5	121646866	splice site	probably null
R8075:Acad10	UTSW	5	121652085	missense	probably benign	0.00
R8400:Acad10	UTSW	5	121626205	missense	possibly damaging	0.82
R9171:Acad10	UTSW	5	121629918	missense	probably benign	0.14
X0061:Acad10	UTSW	5	121622813	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGACAGTTACAGCTTTAAAAGCTCCA -3'
(R):5'- CACAGACGGCCTGCTCCCT -3'

Sequencing Primer
(F):5'- gctcacaactatctcaaactcc -3'
(R):5'- GCTCCCTTCGTCCTGTCAAC -3'

Posted On

2014-04-24