Incidental Mutation 'R1592:Gldc'
ID175698
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission 039629-MU
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1592 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 30160677 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably benign
Transcript: ENSMUST00000025778
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080982
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,645,381 E327G probably damaging Het
Acp5 A T 9: 22,127,851 W189R probably damaging Het
Adamts8 T C 9: 30,943,176 S114P probably damaging Het
Alkbh3 A C 2: 94,008,424 probably null Het
Ankrd13d T C 19: 4,282,891 H27R probably benign Het
Aox2 A G 1: 58,300,694 N382S probably benign Het
Aspg G A 12: 112,119,972 R220Q probably benign Het
Atg16l2 C A 7: 101,291,986 G403V probably damaging Het
Bcat1 G T 6: 145,010,058 Q299K probably benign Het
Cc2d1b C T 4: 108,626,671 probably benign Het
Cdh26 T C 2: 178,449,891 F81S probably damaging Het
Cnbd2 A G 2: 156,335,402 I222M probably benign Het
Ephb3 T C 16: 21,221,700 V562A probably damaging Het
Fam186a T C 15: 99,940,318 T2682A probably benign Het
Fat2 T C 11: 55,291,870 probably null Het
Fat4 A T 3: 39,007,177 D4303V probably damaging Het
Fbln1 T A 15: 85,231,464 S234T probably benign Het
Gli1 A C 10: 127,331,329 V685G probably damaging Het
H2-T22 T C 17: 36,041,577 N152S probably damaging Het
Inpp5d A T 1: 87,665,532 D118V possibly damaging Het
Ints10 A G 8: 68,802,903 I182V possibly damaging Het
Ipcef1 C T 10: 6,935,182 probably null Het
Kcnj3 G T 2: 55,437,886 R229L probably damaging Het
Klf11 C A 12: 24,653,738 D57E probably damaging Het
Krt73 G T 15: 101,802,239 S20* probably null Het
Lactbl1 A G 4: 136,635,876 probably null Het
Mapk10 T C 5: 103,038,621 D45G possibly damaging Het
Mfrp G A 9: 44,103,222 C222Y probably damaging Het
Mga A T 2: 119,964,666 I2944F possibly damaging Het
Msh2 A G 17: 87,680,013 probably null Het
Nckap1l T A 15: 103,482,180 probably null Het
Olfr1034 A G 2: 86,046,989 N169S probably benign Het
Pitpnm1 T A 19: 4,106,964 probably null Het
Sik2 C T 9: 50,995,671 V85I probably damaging Het
Slc26a7 T A 4: 14,552,470 E229V probably benign Het
Spty2d1 A T 7: 46,998,889 D97E possibly damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Uggt1 C A 1: 36,202,858 A332S probably benign Het
Usp53 A T 3: 122,934,050 L961* probably null Het
Vmn1r223 A T 13: 23,249,667 T144S possibly damaging Het
Wdfy1 G A 1: 79,706,255 R388C probably damaging Het
Zfp995 T A 17: 21,887,340 M1L probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACCAGTTAACACCAGAGTCCAGGAG -3'
(R):5'- CGCGTAAGTTACCAGCGTGTAGAG -3'

Sequencing Primer
(F):5'- gtgtctcctaaaacaatacatttgc -3'
(R):5'- TACTCGGCTGCGATATGGAAC -3'
Posted On2014-04-24