Mutagenetix > Incidental Mutation

Incidental Mutation 'R1592:Gldc'

175698

Institutional Source

Beutler Lab

Gene Symbol

Gldc

Ensembl Gene

ENSMUSG00000024827

Gene Name

glycine decarboxylase

Synonyms

D030049L12Rik, D19Wsu57e

MMRRC Submission

039629-MU

Accession Numbers

Genbank: NM_138595.1

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1592 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30098449-30175418 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 30160677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000025778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025778]

AlphaFold

Q91W43

Predicted Effect

probably benign
Transcript: ENSMUST00000025778

SMART Domains

Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827

Domain	Start	End	E-Value	Type
low complexity region	5	28	N/A	INTRINSIC
low complexity region	33	56	N/A	INTRINSIC
Pfam:GDC-P	70	493	1.1e-202	PFAM
low complexity region	504	515	N/A	INTRINSIC
Pfam:GDC-P	519	798	6.5e-8	PFAM
Pfam:Beta_elim_lyase	589	745	2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000080982

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.9%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	T	C	5: 121,645,381	E327G	probably damaging	Het
Acp5	A	T	9: 22,127,851	W189R	probably damaging	Het
Adamts8	T	C	9: 30,943,176	S114P	probably damaging	Het
Alkbh3	A	C	2: 94,008,424		probably null	Het
Ankrd13d	T	C	19: 4,282,891	H27R	probably benign	Het
Aox2	A	G	1: 58,300,694	N382S	probably benign	Het
Aspg	G	A	12: 112,119,972	R220Q	probably benign	Het
Atg16l2	C	A	7: 101,291,986	G403V	probably damaging	Het
Bcat1	G	T	6: 145,010,058	Q299K	probably benign	Het
Cc2d1b	C	T	4: 108,626,671		probably benign	Het
Cdh26	T	C	2: 178,449,891	F81S	probably damaging	Het
Cnbd2	A	G	2: 156,335,402	I222M	probably benign	Het
Ephb3	T	C	16: 21,221,700	V562A	probably damaging	Het
Fam186a	T	C	15: 99,940,318	T2682A	probably benign	Het
Fat2	T	C	11: 55,291,870		probably null	Het
Fat4	A	T	3: 39,007,177	D4303V	probably damaging	Het
Fbln1	T	A	15: 85,231,464	S234T	probably benign	Het
Gli1	A	C	10: 127,331,329	V685G	probably damaging	Het
H2-T22	T	C	17: 36,041,577	N152S	probably damaging	Het
Inpp5d	A	T	1: 87,665,532	D118V	possibly damaging	Het
Ints10	A	G	8: 68,802,903	I182V	possibly damaging	Het
Ipcef1	C	T	10: 6,935,182		probably null	Het
Kcnj3	G	T	2: 55,437,886	R229L	probably damaging	Het
Klf11	C	A	12: 24,653,738	D57E	probably damaging	Het
Krt73	G	T	15: 101,802,239	S20*	probably null	Het
Lactbl1	A	G	4: 136,635,876		probably null	Het
Mapk10	T	C	5: 103,038,621	D45G	possibly damaging	Het
Mfrp	G	A	9: 44,103,222	C222Y	probably damaging	Het
Mga	A	T	2: 119,964,666	I2944F	possibly damaging	Het
Msh2	A	G	17: 87,680,013		probably null	Het
Nckap1l	T	A	15: 103,482,180		probably null	Het
Olfr1034	A	G	2: 86,046,989	N169S	probably benign	Het
Pitpnm1	T	A	19: 4,106,964		probably null	Het
Sik2	C	T	9: 50,995,671	V85I	probably damaging	Het
Slc26a7	T	A	4: 14,552,470	E229V	probably benign	Het
Spty2d1	A	T	7: 46,998,889	D97E	possibly damaging	Het
Tcaim	G	A	9: 122,818,773		probably null	Het
Tdrd3	T	A	14: 87,505,886	N417K	probably damaging	Het
Uggt1	C	A	1: 36,202,858	A332S	probably benign	Het
Usp53	A	T	3: 122,934,050	L961*	probably null	Het
Vmn1r223	A	T	13: 23,249,667	T144S	possibly damaging	Het
Wdfy1	G	A	1: 79,706,255	R388C	probably damaging	Het
Zfp995	T	A	17: 21,887,340	M1L	probably damaging	Het

Other mutations in Gldc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Gldc	APN	19	30115240	missense	probably damaging	1.00
IGL01016:Gldc	APN	19	30133493	missense	possibly damaging	0.93
IGL01112:Gldc	APN	19	30158513	critical splice donor site	probably null
IGL01510:Gldc	APN	19	30113721	critical splice donor site	probably null
IGL01516:Gldc	APN	19	30099032	missense	probably damaging	1.00
IGL01598:Gldc	APN	19	30133756	missense	probably damaging	1.00
IGL01646:Gldc	APN	19	30100765	missense	possibly damaging	0.61
IGL02024:Gldc	APN	19	30100827	missense	probably damaging	1.00
IGL02125:Gldc	APN	19	30147241	missense	probably benign	0.03
IGL02548:Gldc	APN	19	30099899	missense	probably benign
IGL02711:Gldc	APN	19	30145146	critical splice donor site	probably null
IGL02818:Gldc	APN	19	30136509	missense	probably damaging	0.99
IGL02982:Gldc	APN	19	30145145	critical splice donor site	probably null
IGL03165:Gldc	APN	19	30098993	missense	possibly damaging	0.61
jojoba	UTSW	19	30133512	missense	probably damaging	1.00
miserable	UTSW	19	30151536	missense	probably damaging	1.00
Urchin	UTSW	19	30118602	missense	probably damaging	0.98
I2289:Gldc	UTSW	19	30147176	nonsense	probably null
R0180:Gldc	UTSW	19	30100817	missense	possibly damaging	0.95
R0269:Gldc	UTSW	19	30118602	missense	probably damaging	0.98
R0277:Gldc	UTSW	19	30116451	missense	possibly damaging	0.84
R1085:Gldc	UTSW	19	30151428	missense	probably damaging	1.00
R1159:Gldc	UTSW	19	30160762	intron	probably benign
R1500:Gldc	UTSW	19	30113825	missense	possibly damaging	0.88
R1507:Gldc	UTSW	19	30118638	missense	probably damaging	1.00
R1593:Gldc	UTSW	19	30113750	missense	probably damaging	1.00
R1675:Gldc	UTSW	19	30143453	missense	probably damaging	1.00
R1869:Gldc	UTSW	19	30139332	missense	probably benign
R1965:Gldc	UTSW	19	30137113	nonsense	probably null
R2312:Gldc	UTSW	19	30100826	missense	probably damaging	0.98
R2425:Gldc	UTSW	19	30131790	missense	probably damaging	1.00
R3836:Gldc	UTSW	19	30118675	splice site	probably benign
R3837:Gldc	UTSW	19	30118675	splice site	probably benign
R3839:Gldc	UTSW	19	30118675	splice site	probably benign
R4191:Gldc	UTSW	19	30145658	missense	probably damaging	0.96
R4380:Gldc	UTSW	19	30160768	intron	probably benign
R4508:Gldc	UTSW	19	30143407	missense	probably damaging	1.00
R4570:Gldc	UTSW	19	30174439	missense	probably benign
R4655:Gldc	UTSW	19	30160702	intron	probably benign
R4842:Gldc	UTSW	19	30133732	missense	possibly damaging	0.94
R5070:Gldc	UTSW	19	30118598	missense	possibly damaging	0.84
R5085:Gldc	UTSW	19	30151536	missense	probably damaging	1.00
R5268:Gldc	UTSW	19	30145725	missense	probably damaging	0.96
R5368:Gldc	UTSW	19	30158521	missense	probably benign
R5718:Gldc	UTSW	19	30110772	nonsense	probably null
R5878:Gldc	UTSW	19	30143467	splice site	probably null
R6192:Gldc	UTSW	19	30133772	missense	probably damaging	0.98
R6453:Gldc	UTSW	19	30116517	missense	probably damaging	0.99
R6777:Gldc	UTSW	19	30133512	missense	probably damaging	1.00
R6865:Gldc	UTSW	19	30133762	missense	possibly damaging	0.92
R7332:Gldc	UTSW	19	30116526	missense	probably damaging	0.99
R7390:Gldc	UTSW	19	30099914	missense	possibly damaging	0.46
R7647:Gldc	UTSW	19	30118667	missense	probably damaging	0.96
R8081:Gldc	UTSW	19	30158587	frame shift	probably null
R8171:Gldc	UTSW	19	30133761	missense	probably benign	0.24
R8321:Gldc	UTSW	19	30143407	nonsense	probably null
R8374:Gldc	UTSW	19	30137194	missense	probably damaging	1.00
R8503:Gldc	UTSW	19	30099854	missense	probably benign	0.26
R8510:Gldc	UTSW	19	30116505	missense	probably damaging	1.00
R8785:Gldc	UTSW	19	30115234	missense	probably damaging	1.00
R8818:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8820:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8829:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8830:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8859:Gldc	UTSW	19	30139379	missense	probably damaging	1.00
R8887:Gldc	UTSW	19	30133756	missense	possibly damaging	0.94
R8935:Gldc	UTSW	19	30131693	missense	probably benign	0.00
R8940:Gldc	UTSW	19	30151484	missense	probably benign
R9070:Gldc	UTSW	19	30103004	missense	probably damaging	1.00
R9100:Gldc	UTSW	19	30099914	missense	possibly damaging	0.81
R9144:Gldc	UTSW	19	30137193	missense
R9163:Gldc	UTSW	19	30134286	missense	probably benign	0.13
R9429:Gldc	UTSW	19	30113772	missense	possibly damaging	0.88
Z1177:Gldc	UTSW	19	30110778	missense	probably damaging	1.00
Z1177:Gldc	UTSW	19	30110779	missense	probably damaging	0.99
Z1177:Gldc	UTSW	19	30145748	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- ACCAGTTAACACCAGAGTCCAGGAG -3'
(R):5'- CGCGTAAGTTACCAGCGTGTAGAG -3'

Sequencing Primer
(F):5'- gtgtctcctaaaacaatacatttgc -3'
(R):5'- TACTCGGCTGCGATATGGAAC -3'

Posted On

2014-04-24