Incidental Mutation 'R1595:Ptprt'
ID175706
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Nameprotein tyrosine phosphatase, receptor type, T
SynonymsRPTPrho
MMRRC Submission 039632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1595 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location161521990-162661147 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 161810549 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
Predicted Effect probably null
Transcript: ENSMUST00000109441
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109442
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109443
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109445
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,177,300 probably null Het
Abcc10 G T 17: 46,322,238 P556H probably damaging Het
Abcc9 A T 6: 142,633,095 D914E probably benign Het
Adgrf4 A G 17: 42,667,873 V193A probably benign Het
Adm A T 7: 110,629,091 T160S probably damaging Het
Ammecr1l T C 18: 31,772,120 probably null Het
Angpt2 T C 8: 18,698,113 D377G probably damaging Het
Ankfn1 A G 11: 89,422,767 probably null Het
Arhgap30 T G 1: 171,408,341 M761R probably benign Het
Asb4 T G 6: 5,390,692 N28K probably damaging Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Cd177 A T 7: 24,744,964 D696E probably benign Het
Cd200 G A 16: 45,394,851 T123I probably benign Het
Cfap70 A G 14: 20,447,536 V50A probably benign Het
Chaf1b T C 16: 93,905,099 probably null Het
Chgb A C 2: 132,793,737 D533A probably benign Het
Col12a1 A G 9: 79,602,254 Y3041H probably damaging Het
Crot T C 5: 8,974,186 N337D probably benign Het
Csad G A 15: 102,177,782 A51V probably damaging Het
Cyp2b9 A G 7: 26,200,907 Y380C possibly damaging Het
Dpysl2 G T 14: 66,815,503 A299E probably damaging Het
Efcc1 A G 6: 87,731,458 E189G probably damaging Het
Egfr T C 11: 16,906,847 I940T probably damaging Het
Etnk2 T G 1: 133,373,179 L228R possibly damaging Het
Fitm2 A G 2: 163,469,690 I201T probably benign Het
Foxo1 A T 3: 52,345,954 M513L probably benign Het
Galnt16 A T 12: 80,590,636 K379I probably damaging Het
Gm5689 T C 18: 42,173,389 M7T probably benign Het
Gtf2a1 T A 12: 91,589,549 N6Y probably damaging Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Klhdc8b T A 9: 108,451,163 D30V probably damaging Het
Lrrc7 G A 3: 158,177,277 Q448* probably null Het
Med29 T C 7: 28,392,503 D54G probably damaging Het
Mfn2 T C 4: 147,894,696 T60A probably benign Het
Mroh1 T C 15: 76,433,530 probably benign Het
Mxd1 A T 6: 86,651,471 V149E possibly damaging Het
Naip6 A T 13: 100,299,094 Y974N probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nhsl1 G T 10: 18,526,348 K1107N probably damaging Het
Nlrc3 T C 16: 3,965,302 E81G probably benign Het
Olfr119 G T 17: 37,701,113 A148S probably benign Het
Olfr311 G T 11: 58,841,652 M179I probably benign Het
Osbpl5 C T 7: 143,703,218 V392M possibly damaging Het
Pcdhb22 T A 18: 37,520,453 V401E probably damaging Het
Pcm1 T A 8: 41,309,635 H1444Q probably damaging Het
Pdlim2 A G 14: 70,164,744 Y308H probably damaging Het
Phf14 T G 6: 11,988,753 L664R possibly damaging Het
Phkb T C 8: 86,026,553 probably benign Het
Ptchd3 T A 11: 121,830,594 F98I probably damaging Het
Rbp3 A T 14: 33,956,198 H701L possibly damaging Het
Rgl1 T C 1: 152,675,023 probably benign Het
Satb1 A T 17: 51,782,701 S373T possibly damaging Het
Scn3a T A 2: 65,498,979 Y769F probably damaging Het
Senp7 A G 16: 56,184,768 I922V probably damaging Het
Serpina3g A G 12: 104,239,272 E90G probably benign Het
Sh3rf2 C T 18: 42,111,288 T273I probably damaging Het
Slc15a3 A G 19: 10,854,311 T350A probably benign Het
Socs5 T C 17: 87,134,195 C188R probably damaging Het
Tacr1 A G 6: 82,403,742 T45A probably benign Het
Th A G 7: 142,897,008 V117A probably benign Het
Thpo C A 16: 20,728,456 D81Y probably damaging Het
Tmem229b-ps A G 10: 53,475,289 noncoding transcript Het
Trpc4 A G 3: 54,315,815 E724G probably benign Het
Ttn T C 2: 76,746,633 T24639A probably damaging Het
Ulk4 A G 9: 121,044,838 S1176P probably damaging Het
Urgcp T C 11: 5,717,447 D297G probably damaging Het
Vmn1r168 G A 7: 23,541,195 G159D probably damaging Het
Vmn1r67 A T 7: 10,447,670 N226I probably benign Het
Vmn2r27 T C 6: 124,231,615 E57G probably benign Het
Zdhhc14 G T 17: 5,493,556 R37L probably benign Het
Zfp512b G A 2: 181,588,436 T499I probably damaging Het
Zmym2 A T 14: 56,920,730 K575N probably benign Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7576:Ptprt UTSW 2 161607305 missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161575787 missense probably damaging 1.00
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R7813:Ptprt UTSW 2 161530493 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGGAAGATCCTGGCTCAGTGTCTC -3'
(R):5'- TCACGGTGTCCTTAGTACCACTCAC -3'

Sequencing Primer
(F):5'- AGTGTCTCCTTCCAAATTGGGC -3'
(R):5'- TAGGATAGGAAGTGTCAAgggac -3'
Posted On2014-04-24