Incidental Mutation 'R1595:Ptprt'
ID 175706
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 039632-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1595 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 161652469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000109441
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109442
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109443
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109445
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,153,944 (GRCm39) probably null Het
Abcc10 G T 17: 46,633,164 (GRCm39) P556H probably damaging Het
Abcc9 A T 6: 142,578,821 (GRCm39) D914E probably benign Het
Adgrf4 A G 17: 42,978,764 (GRCm39) V193A probably benign Het
Adm A T 7: 110,228,298 (GRCm39) T160S probably damaging Het
Ammecr1l T C 18: 31,905,173 (GRCm39) probably null Het
Angpt2 T C 8: 18,748,129 (GRCm39) D377G probably damaging Het
Ankfn1 A G 11: 89,313,593 (GRCm39) probably null Het
Arhgap30 T G 1: 171,235,909 (GRCm39) M761R probably benign Het
Asb4 T G 6: 5,390,692 (GRCm39) N28K probably damaging Het
Cd177 A T 7: 24,444,389 (GRCm39) D696E probably benign Het
Cd200 G A 16: 45,215,214 (GRCm39) T123I probably benign Het
Cfap70 A G 14: 20,497,604 (GRCm39) V50A probably benign Het
Chaf1b T C 16: 93,701,987 (GRCm39) probably null Het
Chgb A C 2: 132,635,657 (GRCm39) D533A probably benign Het
Col12a1 A G 9: 79,509,536 (GRCm39) Y3041H probably damaging Het
Crot T C 5: 9,024,186 (GRCm39) N337D probably benign Het
Csad G A 15: 102,086,217 (GRCm39) A51V probably damaging Het
Cstdc7 T C 18: 42,306,454 (GRCm39) M7T probably benign Het
Cyp2b9 A G 7: 25,900,332 (GRCm39) Y380C possibly damaging Het
Dpysl2 G T 14: 67,052,952 (GRCm39) A299E probably damaging Het
Efcc1 A G 6: 87,708,440 (GRCm39) E189G probably damaging Het
Egfr T C 11: 16,856,847 (GRCm39) I940T probably damaging Het
Etnk2 T G 1: 133,300,917 (GRCm39) L228R possibly damaging Het
Fitm2 A G 2: 163,311,610 (GRCm39) I201T probably benign Het
Foxo1 A T 3: 52,253,375 (GRCm39) M513L probably benign Het
Galnt16 A T 12: 80,637,410 (GRCm39) K379I probably damaging Het
Gm57858 C T 3: 36,073,146 (GRCm39) A379T probably damaging Het
Gtf2a1 T A 12: 91,556,323 (GRCm39) N6Y probably damaging Het
Kcnc1 G A 7: 46,077,010 (GRCm39) V271M probably benign Het
Klhdc8b T A 9: 108,328,362 (GRCm39) D30V probably damaging Het
Lrrc7 G A 3: 157,882,914 (GRCm39) Q448* probably null Het
Med29 T C 7: 28,091,928 (GRCm39) D54G probably damaging Het
Mfn2 T C 4: 147,979,153 (GRCm39) T60A probably benign Het
Mroh1 T C 15: 76,317,730 (GRCm39) probably benign Het
Mxd1 A T 6: 86,628,453 (GRCm39) V149E possibly damaging Het
Naip6 A T 13: 100,435,602 (GRCm39) Y974N probably damaging Het
Ndn C T 7: 61,998,256 (GRCm39) P34L probably benign Het
Nhsl1 G T 10: 18,402,096 (GRCm39) K1107N probably damaging Het
Nlrc3 T C 16: 3,783,166 (GRCm39) E81G probably benign Het
Or10al3 G T 17: 38,012,004 (GRCm39) A148S probably benign Het
Or9e1 G T 11: 58,732,478 (GRCm39) M179I probably benign Het
Osbpl5 C T 7: 143,256,955 (GRCm39) V392M possibly damaging Het
Pcdhb22 T A 18: 37,653,506 (GRCm39) V401E probably damaging Het
Pcm1 T A 8: 41,762,672 (GRCm39) H1444Q probably damaging Het
Pdlim2 A G 14: 70,402,193 (GRCm39) Y308H probably damaging Het
Phf14 T G 6: 11,988,752 (GRCm39) L664R possibly damaging Het
Phkb T C 8: 86,753,182 (GRCm39) probably benign Het
Ptchd3 T A 11: 121,721,420 (GRCm39) F98I probably damaging Het
Rbp3 A T 14: 33,678,155 (GRCm39) H701L possibly damaging Het
Rgl1 T C 1: 152,550,774 (GRCm39) probably benign Het
Satb1 A T 17: 52,089,729 (GRCm39) S373T possibly damaging Het
Scn3a T A 2: 65,329,323 (GRCm39) Y769F probably damaging Het
Senp7 A G 16: 56,005,131 (GRCm39) I922V probably damaging Het
Serpina3g A G 12: 104,205,531 (GRCm39) E90G probably benign Het
Sh3rf2 C T 18: 42,244,353 (GRCm39) T273I probably damaging Het
Slc15a3 A G 19: 10,831,675 (GRCm39) T350A probably benign Het
Socs5 T C 17: 87,441,623 (GRCm39) C188R probably damaging Het
Tacr1 A G 6: 82,380,723 (GRCm39) T45A probably benign Het
Th A G 7: 142,450,745 (GRCm39) V117A probably benign Het
Thpo C A 16: 20,547,206 (GRCm39) D81Y probably damaging Het
Tmem229b-ps A G 10: 53,351,385 (GRCm39) noncoding transcript Het
Trpc4 A G 3: 54,223,236 (GRCm39) E724G probably benign Het
Ttn T C 2: 76,576,977 (GRCm39) T24639A probably damaging Het
Ulk4 A G 9: 120,873,904 (GRCm39) S1176P probably damaging Het
Urgcp T C 11: 5,667,447 (GRCm39) D297G probably damaging Het
Vmn1r168 G A 7: 23,240,620 (GRCm39) G159D probably damaging Het
Vmn1r67 A T 7: 10,181,597 (GRCm39) N226I probably benign Het
Vmn2r27 T C 6: 124,208,574 (GRCm39) E57G probably benign Het
Zdhhc14 G T 17: 5,543,831 (GRCm39) R37L probably benign Het
Zfp512b G A 2: 181,230,229 (GRCm39) T499I probably damaging Het
Zmym2 A T 14: 57,158,187 (GRCm39) K575N probably benign Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGATCCTGGCTCAGTGTCTC -3'
(R):5'- TCACGGTGTCCTTAGTACCACTCAC -3'

Sequencing Primer
(F):5'- AGTGTCTCCTTCCAAATTGGGC -3'
(R):5'- TAGGATAGGAAGTGTCAAgggac -3'
Posted On 2014-04-24