Incidental Mutation 'R1595:Ulk4'
ID175740
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission 039632-MU
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R1595 (G1)
Quality Score187
Status Validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121044838 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1176 (S1176P)
Ref Sequence ENSEMBL: ENSMUSP00000131342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170406
Predicted Effect probably benign
Transcript: ENSMUST00000171061
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171923
AA Change: S1176P

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: S1176P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.2405 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,177,300 probably null Het
Abcc10 G T 17: 46,322,238 P556H probably damaging Het
Abcc9 A T 6: 142,633,095 D914E probably benign Het
Adgrf4 A G 17: 42,667,873 V193A probably benign Het
Adm A T 7: 110,629,091 T160S probably damaging Het
Ammecr1l T C 18: 31,772,120 probably null Het
Angpt2 T C 8: 18,698,113 D377G probably damaging Het
Ankfn1 A G 11: 89,422,767 probably null Het
Arhgap30 T G 1: 171,408,341 M761R probably benign Het
Asb4 T G 6: 5,390,692 N28K probably damaging Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Cd177 A T 7: 24,744,964 D696E probably benign Het
Cd200 G A 16: 45,394,851 T123I probably benign Het
Cfap70 A G 14: 20,447,536 V50A probably benign Het
Chaf1b T C 16: 93,905,099 probably null Het
Chgb A C 2: 132,793,737 D533A probably benign Het
Col12a1 A G 9: 79,602,254 Y3041H probably damaging Het
Crot T C 5: 8,974,186 N337D probably benign Het
Csad G A 15: 102,177,782 A51V probably damaging Het
Cyp2b9 A G 7: 26,200,907 Y380C possibly damaging Het
Dpysl2 G T 14: 66,815,503 A299E probably damaging Het
Efcc1 A G 6: 87,731,458 E189G probably damaging Het
Egfr T C 11: 16,906,847 I940T probably damaging Het
Etnk2 T G 1: 133,373,179 L228R possibly damaging Het
Fitm2 A G 2: 163,469,690 I201T probably benign Het
Foxo1 A T 3: 52,345,954 M513L probably benign Het
Galnt16 A T 12: 80,590,636 K379I probably damaging Het
Gm5689 T C 18: 42,173,389 M7T probably benign Het
Gtf2a1 T A 12: 91,589,549 N6Y probably damaging Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Klhdc8b T A 9: 108,451,163 D30V probably damaging Het
Lrrc7 G A 3: 158,177,277 Q448* probably null Het
Med29 T C 7: 28,392,503 D54G probably damaging Het
Mfn2 T C 4: 147,894,696 T60A probably benign Het
Mroh1 T C 15: 76,433,530 probably benign Het
Mxd1 A T 6: 86,651,471 V149E possibly damaging Het
Naip6 A T 13: 100,299,094 Y974N probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nhsl1 G T 10: 18,526,348 K1107N probably damaging Het
Nlrc3 T C 16: 3,965,302 E81G probably benign Het
Olfr119 G T 17: 37,701,113 A148S probably benign Het
Olfr311 G T 11: 58,841,652 M179I probably benign Het
Osbpl5 C T 7: 143,703,218 V392M possibly damaging Het
Pcdhb22 T A 18: 37,520,453 V401E probably damaging Het
Pcm1 T A 8: 41,309,635 H1444Q probably damaging Het
Pdlim2 A G 14: 70,164,744 Y308H probably damaging Het
Phf14 T G 6: 11,988,753 L664R possibly damaging Het
Phkb T C 8: 86,026,553 probably benign Het
Ptchd3 T A 11: 121,830,594 F98I probably damaging Het
Ptprt C T 2: 161,810,549 probably null Het
Rbp3 A T 14: 33,956,198 H701L possibly damaging Het
Rgl1 T C 1: 152,675,023 probably benign Het
Satb1 A T 17: 51,782,701 S373T possibly damaging Het
Scn3a T A 2: 65,498,979 Y769F probably damaging Het
Senp7 A G 16: 56,184,768 I922V probably damaging Het
Serpina3g A G 12: 104,239,272 E90G probably benign Het
Sh3rf2 C T 18: 42,111,288 T273I probably damaging Het
Slc15a3 A G 19: 10,854,311 T350A probably benign Het
Socs5 T C 17: 87,134,195 C188R probably damaging Het
Tacr1 A G 6: 82,403,742 T45A probably benign Het
Th A G 7: 142,897,008 V117A probably benign Het
Thpo C A 16: 20,728,456 D81Y probably damaging Het
Tmem229b-ps A G 10: 53,475,289 noncoding transcript Het
Trpc4 A G 3: 54,315,815 E724G probably benign Het
Ttn T C 2: 76,746,633 T24639A probably damaging Het
Urgcp T C 11: 5,717,447 D297G probably damaging Het
Vmn1r168 G A 7: 23,541,195 G159D probably damaging Het
Vmn1r67 A T 7: 10,447,670 N226I probably benign Het
Vmn2r27 T C 6: 124,231,615 E57G probably benign Het
Zdhhc14 G T 17: 5,493,556 R37L probably benign Het
Zfp512b G A 2: 181,588,436 T499I probably damaging Het
Zmym2 A T 14: 56,920,730 K575N probably benign Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAATAAGGTCCCTGCCCAGTC -3'
(R):5'- TGCCTGGAATTGGTGTGAATAGCC -3'

Sequencing Primer
(F):5'- TGCCCAGTCCTGCTGTG -3'
(R):5'- GCCTTCAGTAAAGCATCGTAGTG -3'
Posted On2014-04-24