Incidental Mutation 'R1595:Rbp3'
ID175753
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 039632-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R1595 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33956198 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 701 (H701L)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035695
AA Change: H701L

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: H701L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.1005 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,177,300 probably null Het
Abcc10 G T 17: 46,322,238 P556H probably damaging Het
Abcc9 A T 6: 142,633,095 D914E probably benign Het
Adgrf4 A G 17: 42,667,873 V193A probably benign Het
Adm A T 7: 110,629,091 T160S probably damaging Het
Ammecr1l T C 18: 31,772,120 probably null Het
Angpt2 T C 8: 18,698,113 D377G probably damaging Het
Ankfn1 A G 11: 89,422,767 probably null Het
Arhgap30 T G 1: 171,408,341 M761R probably benign Het
Asb4 T G 6: 5,390,692 N28K probably damaging Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Cd177 A T 7: 24,744,964 D696E probably benign Het
Cd200 G A 16: 45,394,851 T123I probably benign Het
Cfap70 A G 14: 20,447,536 V50A probably benign Het
Chaf1b T C 16: 93,905,099 probably null Het
Chgb A C 2: 132,793,737 D533A probably benign Het
Col12a1 A G 9: 79,602,254 Y3041H probably damaging Het
Crot T C 5: 8,974,186 N337D probably benign Het
Csad G A 15: 102,177,782 A51V probably damaging Het
Cyp2b9 A G 7: 26,200,907 Y380C possibly damaging Het
Dpysl2 G T 14: 66,815,503 A299E probably damaging Het
Efcc1 A G 6: 87,731,458 E189G probably damaging Het
Egfr T C 11: 16,906,847 I940T probably damaging Het
Etnk2 T G 1: 133,373,179 L228R possibly damaging Het
Fitm2 A G 2: 163,469,690 I201T probably benign Het
Foxo1 A T 3: 52,345,954 M513L probably benign Het
Galnt16 A T 12: 80,590,636 K379I probably damaging Het
Gm5689 T C 18: 42,173,389 M7T probably benign Het
Gtf2a1 T A 12: 91,589,549 N6Y probably damaging Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Klhdc8b T A 9: 108,451,163 D30V probably damaging Het
Lrrc7 G A 3: 158,177,277 Q448* probably null Het
Med29 T C 7: 28,392,503 D54G probably damaging Het
Mfn2 T C 4: 147,894,696 T60A probably benign Het
Mroh1 T C 15: 76,433,530 probably benign Het
Mxd1 A T 6: 86,651,471 V149E possibly damaging Het
Naip6 A T 13: 100,299,094 Y974N probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nhsl1 G T 10: 18,526,348 K1107N probably damaging Het
Nlrc3 T C 16: 3,965,302 E81G probably benign Het
Olfr119 G T 17: 37,701,113 A148S probably benign Het
Olfr311 G T 11: 58,841,652 M179I probably benign Het
Osbpl5 C T 7: 143,703,218 V392M possibly damaging Het
Pcdhb22 T A 18: 37,520,453 V401E probably damaging Het
Pcm1 T A 8: 41,309,635 H1444Q probably damaging Het
Pdlim2 A G 14: 70,164,744 Y308H probably damaging Het
Phf14 T G 6: 11,988,753 L664R possibly damaging Het
Phkb T C 8: 86,026,553 probably benign Het
Ptchd3 T A 11: 121,830,594 F98I probably damaging Het
Ptprt C T 2: 161,810,549 probably null Het
Rgl1 T C 1: 152,675,023 probably benign Het
Satb1 A T 17: 51,782,701 S373T possibly damaging Het
Scn3a T A 2: 65,498,979 Y769F probably damaging Het
Senp7 A G 16: 56,184,768 I922V probably damaging Het
Serpina3g A G 12: 104,239,272 E90G probably benign Het
Sh3rf2 C T 18: 42,111,288 T273I probably damaging Het
Slc15a3 A G 19: 10,854,311 T350A probably benign Het
Socs5 T C 17: 87,134,195 C188R probably damaging Het
Tacr1 A G 6: 82,403,742 T45A probably benign Het
Th A G 7: 142,897,008 V117A probably benign Het
Thpo C A 16: 20,728,456 D81Y probably damaging Het
Tmem229b-ps A G 10: 53,475,289 noncoding transcript Het
Trpc4 A G 3: 54,315,815 E724G probably benign Het
Ttn T C 2: 76,746,633 T24639A probably damaging Het
Ulk4 A G 9: 121,044,838 S1176P probably damaging Het
Urgcp T C 11: 5,717,447 D297G probably damaging Het
Vmn1r168 G A 7: 23,541,195 G159D probably damaging Het
Vmn1r67 A T 7: 10,447,670 N226I probably benign Het
Vmn2r27 T C 6: 124,231,615 E57G probably benign Het
Zdhhc14 G T 17: 5,493,556 R37L probably benign Het
Zfp512b G A 2: 181,588,436 T499I probably damaging Het
Zmym2 A T 14: 56,920,730 K575N probably benign Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7758:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
R7845:Rbp3 UTSW 14 33956464 missense probably benign 0.24
R8176:Rbp3 UTSW 14 33955648 missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33956363 missense probably benign 0.00
R8393:Rbp3 UTSW 14 33956199 missense possibly damaging 0.93
Z1177:Rbp3 UTSW 14 33954538 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGAGTTTGCCTTCCTCATGCAGTC -3'
(R):5'- AGGCCCAATGGCCTTTACTGTCTC -3'

Sequencing Primer
(F):5'- TTTATTGACAACCACGGTGAGG -3'
(R):5'- GGCCTTTACTGTCTCTAGCTCAG -3'
Posted On2014-04-24