Incidental Mutation 'R1595:Pdlim2'
ID 175756
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene Name PDZ and LIM domain 2
Synonyms SLIM, 4732462F18Rik, mystique
MMRRC Submission 039632-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R1595 (G1)
Quality Score 176
Status Validated
Chromosome 14
Chromosomal Location 70401667-70415130 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70402193 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 308 (Y308H)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000153735] [ENSMUST00000143393]
AlphaFold Q8R1G6
Predicted Effect probably damaging
Transcript: ENSMUST00000022681
AA Change: Y308H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: Y308H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: Y109H
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: Y109H

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127836
AA Change: Y87H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: Y87H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129174
AA Change: Y87H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: Y87H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably damaging
Transcript: ENSMUST00000153735
AA Change: Y308H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: Y308H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Meta Mutation Damage Score 0.5356 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,153,944 (GRCm39) probably null Het
Abcc10 G T 17: 46,633,164 (GRCm39) P556H probably damaging Het
Abcc9 A T 6: 142,578,821 (GRCm39) D914E probably benign Het
Adgrf4 A G 17: 42,978,764 (GRCm39) V193A probably benign Het
Adm A T 7: 110,228,298 (GRCm39) T160S probably damaging Het
Ammecr1l T C 18: 31,905,173 (GRCm39) probably null Het
Angpt2 T C 8: 18,748,129 (GRCm39) D377G probably damaging Het
Ankfn1 A G 11: 89,313,593 (GRCm39) probably null Het
Arhgap30 T G 1: 171,235,909 (GRCm39) M761R probably benign Het
Asb4 T G 6: 5,390,692 (GRCm39) N28K probably damaging Het
Cd177 A T 7: 24,444,389 (GRCm39) D696E probably benign Het
Cd200 G A 16: 45,215,214 (GRCm39) T123I probably benign Het
Cfap70 A G 14: 20,497,604 (GRCm39) V50A probably benign Het
Chaf1b T C 16: 93,701,987 (GRCm39) probably null Het
Chgb A C 2: 132,635,657 (GRCm39) D533A probably benign Het
Col12a1 A G 9: 79,509,536 (GRCm39) Y3041H probably damaging Het
Crot T C 5: 9,024,186 (GRCm39) N337D probably benign Het
Csad G A 15: 102,086,217 (GRCm39) A51V probably damaging Het
Cstdc7 T C 18: 42,306,454 (GRCm39) M7T probably benign Het
Cyp2b9 A G 7: 25,900,332 (GRCm39) Y380C possibly damaging Het
Dpysl2 G T 14: 67,052,952 (GRCm39) A299E probably damaging Het
Efcc1 A G 6: 87,708,440 (GRCm39) E189G probably damaging Het
Egfr T C 11: 16,856,847 (GRCm39) I940T probably damaging Het
Etnk2 T G 1: 133,300,917 (GRCm39) L228R possibly damaging Het
Fitm2 A G 2: 163,311,610 (GRCm39) I201T probably benign Het
Foxo1 A T 3: 52,253,375 (GRCm39) M513L probably benign Het
Galnt16 A T 12: 80,637,410 (GRCm39) K379I probably damaging Het
Gm57858 C T 3: 36,073,146 (GRCm39) A379T probably damaging Het
Gtf2a1 T A 12: 91,556,323 (GRCm39) N6Y probably damaging Het
Kcnc1 G A 7: 46,077,010 (GRCm39) V271M probably benign Het
Klhdc8b T A 9: 108,328,362 (GRCm39) D30V probably damaging Het
Lrrc7 G A 3: 157,882,914 (GRCm39) Q448* probably null Het
Med29 T C 7: 28,091,928 (GRCm39) D54G probably damaging Het
Mfn2 T C 4: 147,979,153 (GRCm39) T60A probably benign Het
Mroh1 T C 15: 76,317,730 (GRCm39) probably benign Het
Mxd1 A T 6: 86,628,453 (GRCm39) V149E possibly damaging Het
Naip6 A T 13: 100,435,602 (GRCm39) Y974N probably damaging Het
Ndn C T 7: 61,998,256 (GRCm39) P34L probably benign Het
Nhsl1 G T 10: 18,402,096 (GRCm39) K1107N probably damaging Het
Nlrc3 T C 16: 3,783,166 (GRCm39) E81G probably benign Het
Or10al3 G T 17: 38,012,004 (GRCm39) A148S probably benign Het
Or9e1 G T 11: 58,732,478 (GRCm39) M179I probably benign Het
Osbpl5 C T 7: 143,256,955 (GRCm39) V392M possibly damaging Het
Pcdhb22 T A 18: 37,653,506 (GRCm39) V401E probably damaging Het
Pcm1 T A 8: 41,762,672 (GRCm39) H1444Q probably damaging Het
Phf14 T G 6: 11,988,752 (GRCm39) L664R possibly damaging Het
Phkb T C 8: 86,753,182 (GRCm39) probably benign Het
Ptchd3 T A 11: 121,721,420 (GRCm39) F98I probably damaging Het
Ptprt C T 2: 161,652,469 (GRCm39) probably null Het
Rbp3 A T 14: 33,678,155 (GRCm39) H701L possibly damaging Het
Rgl1 T C 1: 152,550,774 (GRCm39) probably benign Het
Satb1 A T 17: 52,089,729 (GRCm39) S373T possibly damaging Het
Scn3a T A 2: 65,329,323 (GRCm39) Y769F probably damaging Het
Senp7 A G 16: 56,005,131 (GRCm39) I922V probably damaging Het
Serpina3g A G 12: 104,205,531 (GRCm39) E90G probably benign Het
Sh3rf2 C T 18: 42,244,353 (GRCm39) T273I probably damaging Het
Slc15a3 A G 19: 10,831,675 (GRCm39) T350A probably benign Het
Socs5 T C 17: 87,441,623 (GRCm39) C188R probably damaging Het
Tacr1 A G 6: 82,380,723 (GRCm39) T45A probably benign Het
Th A G 7: 142,450,745 (GRCm39) V117A probably benign Het
Thpo C A 16: 20,547,206 (GRCm39) D81Y probably damaging Het
Tmem229b-ps A G 10: 53,351,385 (GRCm39) noncoding transcript Het
Trpc4 A G 3: 54,223,236 (GRCm39) E724G probably benign Het
Ttn T C 2: 76,576,977 (GRCm39) T24639A probably damaging Het
Ulk4 A G 9: 120,873,904 (GRCm39) S1176P probably damaging Het
Urgcp T C 11: 5,667,447 (GRCm39) D297G probably damaging Het
Vmn1r168 G A 7: 23,240,620 (GRCm39) G159D probably damaging Het
Vmn1r67 A T 7: 10,181,597 (GRCm39) N226I probably benign Het
Vmn2r27 T C 6: 124,208,574 (GRCm39) E57G probably benign Het
Zdhhc14 G T 17: 5,543,831 (GRCm39) R37L probably benign Het
Zfp512b G A 2: 181,230,229 (GRCm39) T499I probably damaging Het
Zmym2 A T 14: 57,158,187 (GRCm39) K575N probably benign Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70,403,532 (GRCm39) splice site probably benign
IGL02338:Pdlim2 APN 14 70,411,906 (GRCm39) missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70,411,925 (GRCm39) missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70,403,579 (GRCm39) missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70,411,773 (GRCm39) splice site probably benign
R1689:Pdlim2 UTSW 14 70,408,688 (GRCm39) missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70,411,784 (GRCm39) critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70,403,549 (GRCm39) missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70,405,464 (GRCm39) unclassified probably benign
R4971:Pdlim2 UTSW 14 70,405,208 (GRCm39) missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70,405,229 (GRCm39) missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70,405,137 (GRCm39) missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70,411,826 (GRCm39) missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70,403,645 (GRCm39) missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70,408,924 (GRCm39) missense probably benign
R8342:Pdlim2 UTSW 14 70,403,563 (GRCm39) missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign
R9361:Pdlim2 UTSW 14 70,402,190 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTAGCAACCTGACATTAGTCCC -3'
(R):5'- TGCCCTGAGATCTATGTGTCTGAGG -3'

Sequencing Primer
(F):5'- CATGTAAGATCATCTATCACCTGC -3'
(R):5'- CTGAGGTTCTGACTGTCAAGAG -3'
Posted On 2014-04-24