Incidental Mutation 'R1596:Casp8'
ID175776
Institutional Source Beutler Lab
Gene Symbol Casp8
Ensembl Gene ENSMUSG00000026029
Gene Namecaspase 8
SynonymsMACH, Mch5, FLICE, Caspase-8
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1596 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58795374-58847503 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 58831674 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027189] [ENSMUST00000165549] [ENSMUST00000190213] [ENSMUST00000191201]
Predicted Effect probably benign
Transcript: ENSMUST00000027189
SMART Domains Protein: ENSMUSP00000027189
Gene: ENSMUSG00000026029

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165549
SMART Domains Protein: ENSMUSP00000127375
Gene: ENSMUSG00000026029

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190213
SMART Domains Protein: ENSMUSP00000140335
Gene: ENSMUSG00000026029

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191201
SMART Domains Protein: ENSMUSP00000140546
Gene: ENSMUSG00000026029

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: This gene is part of a family of caspases, aspartate-specific cysteine proteases well studied for their involvement in immune and apoptosis signaling. This protein, an initiator of apoptotic cell death, is activated by death-inducing tumor necrosis family receptors and targets downstream effectors. In mouse deficiency of this gene can cause embryonic lethality. This protein may have a role in embryogenesis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired cardiac muscle development, cardiac erythrocyte congestion, low numbers of colony-forming cells, and prenatal lethality. T-cell restricted knockout mice are viable, but immunodeficient. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Casp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Casp8 APN 1 58827314 critical splice donor site probably null
IGL00825:Casp8 APN 1 58829006 missense probably benign 0.02
IGL02025:Casp8 APN 1 58824147 missense possibly damaging 0.81
IGL02549:Casp8 APN 1 58833766 missense probably benign
amontillado UTSW 1 58844770 missense probably damaging 1.00
Porto UTSW 1 58833698 missense possibly damaging 0.89
IGL02991:Casp8 UTSW 1 58827279 missense probably benign 0.00
R0609:Casp8 UTSW 1 58844792 missense probably benign 0.00
R0960:Casp8 UTSW 1 58829013 critical splice donor site probably null
R1433:Casp8 UTSW 1 58824124 missense probably damaging 1.00
R1505:Casp8 UTSW 1 58828922 missense probably damaging 0.99
R1506:Casp8 UTSW 1 58824196 missense probably damaging 0.97
R1674:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1676:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1981:Casp8 UTSW 1 58828962 splice site probably null
R3909:Casp8 UTSW 1 58844811 missense probably damaging 1.00
R3911:Casp8 UTSW 1 58833705 missense probably damaging 1.00
R4231:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4233:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4234:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4235:Casp8 UTSW 1 58833698 missense possibly damaging 0.89
R4236:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4917:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R4918:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R5063:Casp8 UTSW 1 58844374 missense probably damaging 1.00
R5092:Casp8 UTSW 1 58844676 missense possibly damaging 0.53
R5153:Casp8 UTSW 1 58844845 missense probably benign 0.00
R5964:Casp8 UTSW 1 58833736 missense possibly damaging 0.62
R5979:Casp8 UTSW 1 58828912 missense probably benign
R7602:Casp8 UTSW 1 58833739 missense probably benign 0.43
R7675:Casp8 UTSW 1 58823947 missense possibly damaging 0.69
R8272:Casp8 UTSW 1 58833742 missense probably damaging 0.96
R8714:Casp8 UTSW 1 58833653 missense possibly damaging 0.57
R8747:Casp8 UTSW 1 58844458 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAGAACGCACACATTCACGTACAT -3'
(R):5'- AAAACCTGCCAGAGAAAGTCCTGAAG -3'

Sequencing Primer
(F):5'- TGGTTGCTTGCAGAGATGAG -3'
(R):5'- ttgggaagtaaaggcaggg -3'
Posted On2014-04-24