Incidental Mutation 'R1596:Cst10'
ID175786
Institutional Source Beutler Lab
Gene Symbol Cst10
Ensembl Gene ENSMUSG00000033156
Gene Namecystatin 10 (chondrocytes)
SynonymsDD72
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1596 (G1)
Quality Score185
Status Validated
Chromosome2
Chromosomal Location149405057-149410293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149405409 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 15 (V15A)
Ref Sequence ENSEMBL: ENSMUSP00000105565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047008] [ENSMUST00000109938] [ENSMUST00000109939]
Predicted Effect unknown
Transcript: ENSMUST00000047008
AA Change: V15A
SMART Domains Protein: ENSMUSP00000043520
Gene: ENSMUSG00000033156
AA Change: V15A

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
CY 36 146 4.13e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109938
AA Change: V15A
SMART Domains Protein: ENSMUSP00000105564
Gene: ENSMUSG00000033156
AA Change: V15A

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
CY 36 146 4.13e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000109939
AA Change: V15A
SMART Domains Protein: ENSMUSP00000105565
Gene: ENSMUSG00000033156
AA Change: V15A

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
CY 36 108 2.52e-7 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein found in saliva and tears. The encoded protein may play a protective role against proteinases present in the oral cavity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display reduced chondrocyte calcification during endochondral ossification both under physiological and pathological conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Cst10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cst10 APN 2 149405373 missense unknown
IGL00500:Cst10 APN 2 149405581 missense probably damaging 0.98
IGL00645:Cst10 APN 2 149409979 missense probably damaging 1.00
R4810:Cst10 UTSW 2 149405543 nonsense probably null
R7468:Cst10 UTSW 2 149405576 missense probably benign 0.30
R7469:Cst10 UTSW 2 149405576 missense probably benign 0.30
R7471:Cst10 UTSW 2 149405576 missense probably benign 0.30
R7472:Cst10 UTSW 2 149405576 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGTAGAGTCCAAGGTGACCTGGAG -3'
(R):5'- CGCTCATCAGTCGTATTGGCTTGC -3'

Sequencing Primer
(F):5'- CTAGGACTTATGAAAAGAGAGCCC -3'
(R):5'- CTTGCTAAGATACAGGTCATTGTCC -3'
Posted On2014-04-24