Incidental Mutation 'R1596:Nlrp4c'
ID175799
Institutional Source Beutler Lab
Gene Symbol Nlrp4c
Ensembl Gene ENSMUSG00000034690
Gene NameNLR family, pyrin domain containing 4C
SynonymsNalp-alpha, Rnh2, Nalp4c
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1596 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6045161-6105150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6066778 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 559 (D559E)
Ref Sequence ENSEMBL: ENSMUSP00000146613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037728] [ENSMUST00000121583] [ENSMUST00000208360]
Predicted Effect probably benign
Transcript: ENSMUST00000037728
AA Change: D559E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046503
Gene: ENSMUSG00000034690
AA Change: D559E

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 4.5e-40 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121583
AA Change: D559E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113824
Gene: ENSMUSG00000034690
AA Change: D559E

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 1.7e-39 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207267
Predicted Effect probably benign
Transcript: ENSMUST00000208360
AA Change: D559E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Nlrp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Nlrp4c APN 7 6066702 missense possibly damaging 0.80
IGL01458:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01464:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01470:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01481:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01531:Nlrp4c APN 7 6060656 missense probably damaging 1.00
IGL01595:Nlrp4c APN 7 6066112 nonsense probably null
IGL02087:Nlrp4c APN 7 6092583 missense probably damaging 1.00
IGL02226:Nlrp4c APN 7 6066829 missense possibly damaging 0.78
IGL02588:Nlrp4c APN 7 6084648 missense probably benign 0.25
IGL02822:Nlrp4c APN 7 6065727 missense probably damaging 1.00
IGL02884:Nlrp4c APN 7 6098952 missense probably damaging 1.00
IGL02943:Nlrp4c APN 7 6065975 missense probably damaging 0.96
IGL03017:Nlrp4c APN 7 6084680 missense probably benign 0.23
R0347:Nlrp4c UTSW 7 6066416 missense possibly damaging 0.69
R0579:Nlrp4c UTSW 7 6060845 missense probably benign 0.05
R1051:Nlrp4c UTSW 7 6065943 missense probably benign 0.01
R1636:Nlrp4c UTSW 7 6066738 missense possibly damaging 0.64
R1739:Nlrp4c UTSW 7 6073222 missense probably damaging 1.00
R1766:Nlrp4c UTSW 7 6073114 missense probably benign 0.00
R1824:Nlrp4c UTSW 7 6066956 splice site probably null
R1827:Nlrp4c UTSW 7 6065766 missense probably damaging 1.00
R1858:Nlrp4c UTSW 7 6084656 missense probably benign 0.02
R1902:Nlrp4c UTSW 7 6065819 missense probably damaging 0.98
R2217:Nlrp4c UTSW 7 6073114 missense probably benign
R2415:Nlrp4c UTSW 7 6066048 missense probably damaging 1.00
R3004:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3005:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3410:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3411:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3710:Nlrp4c UTSW 7 6065628 missense probably damaging 0.99
R4072:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4073:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4075:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4076:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4542:Nlrp4c UTSW 7 6100827 nonsense probably null
R4709:Nlrp4c UTSW 7 6065425 missense probably benign 0.31
R4776:Nlrp4c UTSW 7 6066126 missense probably benign 0.41
R5043:Nlrp4c UTSW 7 6066825 missense probably benign 0.01
R5258:Nlrp4c UTSW 7 6066623 missense probably benign 0.06
R6164:Nlrp4c UTSW 7 6092508 missense probably damaging 1.00
R6383:Nlrp4c UTSW 7 6066053 missense probably benign
R6650:Nlrp4c UTSW 7 6065949 missense probably damaging 0.99
R6810:Nlrp4c UTSW 7 6066755 missense probably damaging 1.00
R7095:Nlrp4c UTSW 7 6060793 missense probably damaging 0.97
R7102:Nlrp4c UTSW 7 6065709 nonsense probably null
R7104:Nlrp4c UTSW 7 6065709 nonsense probably null
R7232:Nlrp4c UTSW 7 6065709 nonsense probably null
R7444:Nlrp4c UTSW 7 6092596 nonsense probably null
R7705:Nlrp4c UTSW 7 6072636 missense probably damaging 0.97
X0060:Nlrp4c UTSW 7 6065918 missense probably damaging 1.00
Z1088:Nlrp4c UTSW 7 6066636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCCACACTGCTGGACGTAA -3'
(R):5'- TCAGGACATTCTGGGTTGACAAGGA -3'

Sequencing Primer
(F):5'- TATCTGCTAAAGAGCCACATGG -3'
(R):5'- GGATAGTTTCTTCAGTGTAGAACAG -3'
Posted On2014-04-24