Incidental Mutation 'R1596:Prcp'
ID175802
Institutional Source Beutler Lab
Gene Symbol Prcp
Ensembl Gene ENSMUSG00000061119
Gene Nameprolylcarboxypeptidase (angiotensinase C)
Synonyms2510048K03Rik, 2610104A14Rik
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1596 (G1)
Quality Score211
Status Validated
Chromosome7
Chromosomal Location92874470-92934583 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 92917834 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076052] [ENSMUST00000207594]
Predicted Effect probably benign
Transcript: ENSMUST00000076052
SMART Domains Protein: ENSMUSP00000075429
Gene: ENSMUSG00000061119

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Peptidase_S37 20 211 1.4e-4 PFAM
Pfam:Peptidase_S28 53 475 3.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207594
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S28 family of serine exopeptidases. The encoded preproprotein is proteolytically processed to generate the mature lysosomal prolylcarboxypeptidase. This enzyme cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. A pseudogene of this gene has been identified on chromosome 2. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body length, weight, and fat pads with resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Prcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Prcp APN 7 92933099 missense probably benign 0.00
IGL01124:Prcp APN 7 92910208 missense probably benign 0.01
IGL01538:Prcp APN 7 92910213 missense probably benign 0.09
IGL02005:Prcp APN 7 92927824 missense probably benign 0.01
IGL02160:Prcp APN 7 92917761 missense probably benign 0.02
IGL02548:Prcp APN 7 92901174 missense probably damaging 0.98
R0140:Prcp UTSW 7 92928611 missense probably damaging 1.00
R0480:Prcp UTSW 7 92919082 missense probably damaging 1.00
R0989:Prcp UTSW 7 92910216 missense probably benign 0.04
R1216:Prcp UTSW 7 92917746 missense probably benign
R1823:Prcp UTSW 7 92928675 missense probably damaging 0.98
R2132:Prcp UTSW 7 92901280 missense probably benign 0.01
R2206:Prcp UTSW 7 92928612 missense probably damaging 1.00
R4761:Prcp UTSW 7 92917725 splice site probably null
R5000:Prcp UTSW 7 92919160 missense probably damaging 0.99
R5320:Prcp UTSW 7 92928635 missense probably benign 0.01
R5969:Prcp UTSW 7 92917766 missense probably benign 0.01
R6013:Prcp UTSW 7 92927768 missense possibly damaging 0.72
R6298:Prcp UTSW 7 92928633 missense probably damaging 1.00
R7733:Prcp UTSW 7 92901298 missense probably damaging 1.00
R7852:Prcp UTSW 7 92928692 missense probably benign 0.33
R8032:Prcp UTSW 7 92928698 missense probably damaging 1.00
R8317:Prcp UTSW 7 92875390 missense probably benign 0.05
R8869:Prcp UTSW 7 92910310 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGCCCCTATCTGGCAGCTTGA -3'
(R):5'- CAGCAGCAACGGGTTGATGAGA -3'

Sequencing Primer
(F):5'- CAGCTTGATGGTATGGTTCCC -3'
(R):5'- aaaagaaaaaaaggggggatgg -3'
Posted On2014-04-24