Incidental Mutation 'R1596:Olfr519'
ID175804
Institutional Source Beutler Lab
Gene Symbol Olfr519
Ensembl Gene ENSMUSG00000066239
Gene Nameolfactory receptor 519
SynonymsGA_x6K02T2PBJ9-11224559-11223615, MOR268-6
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1596 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108893461-108894420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108893879 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 176 (H176L)
Ref Sequence ENSEMBL: ENSMUSP00000144271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084752] [ENSMUST00000202706]
Predicted Effect probably damaging
Transcript: ENSMUST00000084752
AA Change: H181L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081804
Gene: ENSMUSG00000066239
AA Change: H181L

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.3e-59 PFAM
Pfam:7TM_GPCR_Srsx 40 310 3.3e-6 PFAM
Pfam:7tm_1 46 305 3.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202706
AA Change: H176L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144271
Gene: ENSMUSG00000066239
AA Change: H176L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-5 PFAM
Pfam:7tm_1 41 300 1.2e-24 PFAM
Meta Mutation Damage Score 0.3437 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Olfr519
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Olfr519 APN 7 108894085 missense probably benign 0.22
IGL02043:Olfr519 APN 7 108893839 nonsense probably null
PIT4382001:Olfr519 UTSW 7 108894102 missense probably damaging 1.00
R1183:Olfr519 UTSW 7 108893741 missense probably damaging 1.00
R1647:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R1648:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R3952:Olfr519 UTSW 7 108893982 missense probably benign 0.00
R4611:Olfr519 UTSW 7 108894117 missense probably damaging 1.00
R4723:Olfr519 UTSW 7 108893821 missense probably benign 0.09
R5838:Olfr519 UTSW 7 108894085 missense probably benign 0.22
R6483:Olfr519 UTSW 7 108894111 missense possibly damaging 0.76
R6516:Olfr519 UTSW 7 108893765 missense probably damaging 1.00
R7353:Olfr519 UTSW 7 108894222 missense probably damaging 1.00
R7748:Olfr519 UTSW 7 108894078 missense probably benign 0.22
Z1088:Olfr519 UTSW 7 108893773 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGCTGTGCCATAGAAGAGGATG -3'
(R):5'- GATTTGCTGCAATCTGCCACCC -3'

Sequencing Primer
(F):5'- CTTCTGCCTCCCTGTAGTGG -3'
(R):5'- CTCTGACCTACCCAGTGATTATGAG -3'
Posted On2014-04-24