Incidental Mutation 'R1596:Abca8a'
ID175821
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission 039633-MU
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1596 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110068060 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 745 (Y745F)
Ref Sequence ENSEMBL: ENSMUSP00000045808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046223
AA Change: Y745F

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: Y745F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100287
AA Change: Y746F

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: Y746F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106664
AA Change: Y746F

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: Y746F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129810
Predicted Effect probably benign
Transcript: ENSMUST00000146635
SMART Domains Protein: ENSMUSP00000114393
Gene: ENSMUSG00000041828

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ABC_tran 114 210 4.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154849
Meta Mutation Damage Score 0.0913 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
PIT4445001:Abca8a UTSW 11 110075551 missense probably damaging 0.99
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 intron probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
R7022:Abca8a UTSW 11 110083500 missense probably damaging 1.00
R7161:Abca8a UTSW 11 110074142 missense probably benign 0.09
R7198:Abca8a UTSW 11 110078655 missense probably damaging 1.00
R7220:Abca8a UTSW 11 110089967 missense probably benign 0.00
R7290:Abca8a UTSW 11 110030888 missense probably benign 0.03
R7381:Abca8a UTSW 11 110030087 intron probably null
R7437:Abca8a UTSW 11 110050964 missense probably benign
R7733:Abca8a UTSW 11 110054587 missense probably benign 0.02
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGTCTCTGAGGTGTGACACTCATTG -3'
(R):5'- GAAATTTGAGAAAGCCAAGCACAGATGT -3'

Sequencing Primer
(F):5'- GAGTGATGCTTCATCTCAAACGC -3'
(R):5'- TATAGATGCTCTTCCCTGGTTG -3'
Posted On2014-04-24