Incidental Mutation 'R1596:Gli3'
ID 175828
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission 039633-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1596 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 15900056 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1148 (Q1148K)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
AlphaFold Q61602
Predicted Effect possibly damaging
Transcript: ENSMUST00000110510
AA Change: Q1148K

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: Q1148K

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,426,018 (GRCm39) probably benign Het
Abca8a T A 11: 109,958,886 (GRCm39) Y745F possibly damaging Het
Abl1 A G 2: 31,680,350 (GRCm39) N316S probably damaging Het
Ackr2 T C 9: 121,738,278 (GRCm39) F218L probably damaging Het
Adam6b T A 12: 113,454,646 (GRCm39) Y488N probably damaging Het
Arhgap10 A G 8: 78,177,326 (GRCm39) I103T possibly damaging Het
Atm A G 9: 53,364,678 (GRCm39) V2669A probably damaging Het
Atp10b A G 11: 43,126,594 (GRCm39) K1117E probably damaging Het
Brinp3 T C 1: 146,390,520 (GRCm39) V22A probably benign Het
Casp8 G T 1: 58,870,833 (GRCm39) probably benign Het
Ccdc178 T A 18: 22,153,930 (GRCm39) K626N possibly damaging Het
Clcn6 T A 4: 148,107,836 (GRCm39) S193C probably damaging Het
Col11a1 C T 3: 113,946,262 (GRCm39) probably benign Het
Csn1s2b T A 5: 87,966,917 (GRCm39) probably benign Het
Cst5 T C 2: 149,247,329 (GRCm39) V15A unknown Het
Cttnbp2 A G 6: 18,408,591 (GRCm39) F1010S probably damaging Het
Dlg2 T C 7: 92,080,259 (GRCm39) V614A probably damaging Het
Dsg1c A G 18: 20,415,104 (GRCm39) Y667C probably damaging Het
Ep400 A T 5: 110,856,727 (GRCm39) probably benign Het
Fam83c C T 2: 155,672,982 (GRCm39) probably null Het
Fbxw20 C T 9: 109,050,368 (GRCm39) C419Y probably damaging Het
Fgd2 G A 17: 29,595,904 (GRCm39) V521I probably benign Het
Frrs1 A G 3: 116,676,848 (GRCm39) probably benign Het
Hdac5 G T 11: 102,095,482 (GRCm39) probably null Het
Ice1 C T 13: 70,753,014 (GRCm39) R1024H possibly damaging Het
Irak3 A T 10: 120,018,451 (GRCm39) I99N probably damaging Het
Klhl31 A G 9: 77,557,356 (GRCm39) D24G probably damaging Het
Lrba C T 3: 86,257,611 (GRCm39) Q1292* probably null Het
Map1a C T 2: 121,120,246 (GRCm39) A44V probably benign Het
Mbd2 T A 18: 70,749,703 (GRCm39) M306K probably damaging Het
Mrc1 C T 2: 14,253,701 (GRCm39) H241Y possibly damaging Het
Mrgprg A G 7: 143,318,431 (GRCm39) F227S possibly damaging Het
Ncapg2 T A 12: 116,382,856 (GRCm39) L229H probably damaging Het
Ncf4 G A 15: 78,134,637 (GRCm39) E30K probably damaging Het
Nlrp4c C A 7: 6,069,777 (GRCm39) D559E probably benign Het
Nxpe4 T A 9: 48,307,855 (GRCm39) W320R probably damaging Het
Or10a3n T A 7: 108,493,086 (GRCm39) H176L probably damaging Het
Or52n4b T A 7: 108,144,290 (GRCm39) M184K possibly damaging Het
Or6z5 T C 7: 6,477,514 (GRCm39) L135P probably damaging Het
Pdzrn3 A G 6: 101,127,966 (GRCm39) V900A probably benign Het
Prcp T C 7: 92,567,042 (GRCm39) probably benign Het
Prkaa2 A T 4: 104,893,526 (GRCm39) D474E probably damaging Het
Prl3a1 A G 13: 27,443,600 (GRCm39) probably benign Het
Ptpra T A 2: 130,386,872 (GRCm39) Y624N probably damaging Het
Ramp1 T C 1: 91,151,022 (GRCm39) V129A possibly damaging Het
Reep1 G T 6: 71,733,421 (GRCm39) probably null Het
Robo3 C T 9: 37,335,928 (GRCm39) probably null Het
Sapcd2 T A 2: 25,266,422 (GRCm39) I403N probably damaging Het
Sdk2 T A 11: 113,729,435 (GRCm39) probably benign Het
Serpinb3a T C 1: 106,974,904 (GRCm39) M210V probably benign Het
Slc45a3 T A 1: 131,909,267 (GRCm39) I488N probably damaging Het
Tnrc6c C T 11: 117,648,867 (GRCm39) P1513S probably damaging Het
Trank1 T A 9: 111,195,358 (GRCm39) H1127Q possibly damaging Het
Trim67 T C 8: 125,552,878 (GRCm39) V660A probably damaging Het
Ubash3b A G 9: 40,942,793 (GRCm39) I233T probably benign Het
Unkl A G 17: 25,424,707 (GRCm39) R245G probably null Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0616:Gli3 UTSW 13 15,836,991 (GRCm39) missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAAGACCTCCTGCCAGATGATG -3'
(R):5'- CCCACTGTGGATTGCAAAGTGCTC -3'

Sequencing Primer
(F):5'- CCTGCCAGATGATGTGGTACAG -3'
(R):5'- AACCTTCCACAGATTATGTGGGTG -3'
Posted On 2014-04-24