Incidental Mutation 'R1596:Ice1'
ID175831
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R1596 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70604895 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1024 (R1024H)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043493
AA Change: R1024H

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: R1024H

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 intron probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCTTCAAGTGCGGAGGTCAG -3'
(R):5'- AACCACACAGTCAGGTGCCAGTAG -3'

Sequencing Primer
(F):5'- GTCAGATCACCTACATCTGAGGG -3'
(R):5'- TGCCAGTAGGCTGGAGG -3'
Posted On2014-04-24