Incidental Mutation 'R1596:Ncf4'
ID175833
Institutional Source Beutler Lab
Gene Symbol Ncf4
Ensembl Gene ENSMUSG00000071715
Gene Nameneutrophil cytosolic factor 4
Synonymsp40phox
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1596 (G1)
Quality Score159
Status Validated
Chromosome15
Chromosomal Location78244801-78262580 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78250437 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 30 (E30K)
Ref Sequence ENSEMBL: ENSMUSP00000121191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096357] [ENSMUST00000133618]
Predicted Effect probably damaging
Transcript: ENSMUST00000096357
AA Change: E30K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000094084
Gene: ENSMUSG00000071715
AA Change: E30K

DomainStartEndE-ValueType
PX 18 136 3.16e-28 SMART
SH3 173 228 2.24e-19 SMART
PB1 237 329 8.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126028
Predicted Effect probably damaging
Transcript: ENSMUST00000133618
AA Change: E30K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121191
Gene: ENSMUSG00000071715
AA Change: E30K

DomainStartEndE-ValueType
PX 18 136 3.16e-28 SMART
SH3 173 228 2.24e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147303
Meta Mutation Damage Score 0.8369 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase, a multicomponent enzyme system important for host defense. This protein is preferentially expressed in cells of myeloid lineage. It interacts primarily with neutrophil cytosolic factor 2 (NCF2/p67-phox) to form a complex with neutrophil cytosolic factor 1 (NCF1/p47-phox), which further interacts with the small G protein RAC1 and translocates to the membrane upon cell stimulation. This complex then activates flavocytochrome b, the membrane-integrated catalytic core of the enzyme system. The PX domain of this protein can bind phospholipid products of the PI(3) kinase, which suggests its role in PI(3) kinase-mediated signaling events. The phosphorylation of this protein was found to negatively regulate the enzyme activity. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable but show impaired NADPH oxidase responses of neutrophils to a variety of stimuli and defective killing of S. aureus in vitro and in vivo. Homozygotes for a knock-in allele that prevents PtdIns3P binding to thePX domain fail in development prior to E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Ncf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Ncf4 APN 15 78255986 missense probably damaging 1.00
IGL02546:Ncf4 APN 15 78261019 missense probably damaging 1.00
IGL03064:Ncf4 APN 15 78250902 missense probably damaging 1.00
IGL03407:Ncf4 APN 15 78254781 splice site probably benign
R0281:Ncf4 UTSW 15 78250883 missense probably damaging 0.96
R0378:Ncf4 UTSW 15 78253303 missense probably damaging 0.98
R1513:Ncf4 UTSW 15 78262360 missense probably benign
R1652:Ncf4 UTSW 15 78261034 missense possibly damaging 0.83
R1815:Ncf4 UTSW 15 78250402 missense probably benign 0.00
R1847:Ncf4 UTSW 15 78250382 missense probably benign 0.33
R1927:Ncf4 UTSW 15 78260646 missense probably damaging 1.00
R2984:Ncf4 UTSW 15 78262320 missense probably benign 0.09
R4302:Ncf4 UTSW 15 78260762 unclassified probably benign
R4649:Ncf4 UTSW 15 78255989 missense possibly damaging 0.61
R4905:Ncf4 UTSW 15 78254904 missense probably damaging 0.99
R5114:Ncf4 UTSW 15 78262393 unclassified probably benign
R5531:Ncf4 UTSW 15 78260788 unclassified probably benign
R5799:Ncf4 UTSW 15 78250977 missense probably benign 0.00
R7284:Ncf4 UTSW 15 78260702 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGACCTGGCAAGTTCTTGGGTAG -3'
(R):5'- ACTGAGTGGGGTAAGCCTTCAGTG -3'

Sequencing Primer
(F):5'- TGGTGACACCAATTCCAGCTC -3'
(R):5'- AAGCCTTCAGTGTGGTGTCC -3'
Posted On2014-04-24