Incidental Mutation 'R1596:Dsg1c'
ID175836
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1596 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20282047 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 667 (Y667C)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably damaging
Transcript: ENSMUST00000054128
AA Change: Y667C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: Y667C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Meta Mutation Damage Score 0.9129 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mbd2 T A 18: 70,616,632 M306K probably damaging Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGACTCTACAGGAGCCCTTGCG -3'
(R):5'- AGCCACAGGCACTGTTTAACTGAG -3'

Sequencing Primer
(F):5'- CTTGAGTCAGTTTGAGATCCAAC -3'
(R):5'- GGCACTGTTTAACTGAGAGAGG -3'
Posted On2014-04-24