Incidental Mutation 'R1596:Mbd2'
ID175838
Institutional Source Beutler Lab
Gene Symbol Mbd2
Ensembl Gene ENSMUSG00000024513
Gene Namemethyl-CpG binding domain protein 2
SynonymsMBD2a
MMRRC Submission 039633-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1596 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location70568189-70626131 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70616632 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 306 (M306K)
Ref Sequence ENSEMBL: ENSMUSP00000073701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074058] [ENSMUST00000127260]
Predicted Effect probably damaging
Transcript: ENSMUST00000074058
AA Change: M306K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073701
Gene: ENSMUSG00000024513
AA Change: M306K

DomainStartEndE-ValueType
low complexity region 15 31 N/A INTRINSIC
low complexity region 48 128 N/A INTRINSIC
low complexity region 133 145 N/A INTRINSIC
MBD 150 223 1.65e-29 SMART
Pfam:MBDa 226 295 1.3e-32 PFAM
Pfam:MBD_C 299 390 7.9e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133889
Meta Mutation Damage Score 0.4334 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. The protein encoded by this gene may function as a mediator of the biological consequences of the methylation signal. It is also reported that the this protein functions as a demethylase to activate transcription, as DNA methylation causes gene silencing. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for disruption sin this gene are grossly normal. Maternal nurturing problems exist however and they are somewhat resistant to dumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,425,774 probably benign Het
Abca8a T A 11: 110,068,060 Y745F possibly damaging Het
Abl1 A G 2: 31,790,338 N316S probably damaging Het
Ackr2 T C 9: 121,909,212 F218L probably damaging Het
Adam6b T A 12: 113,491,026 Y488N probably damaging Het
Arhgap10 A G 8: 77,450,697 I103T possibly damaging Het
Atm A G 9: 53,453,378 V2669A probably damaging Het
Atp10b A G 11: 43,235,767 K1117E probably damaging Het
Brinp3 T C 1: 146,514,782 V22A probably benign Het
Casp8 G T 1: 58,831,674 probably benign Het
Ccdc178 T A 18: 22,020,873 K626N possibly damaging Het
Clcn6 T A 4: 148,023,379 S193C probably damaging Het
Col11a1 C T 3: 114,152,613 probably benign Het
Csn1s2b T A 5: 87,819,058 probably benign Het
Cst10 T C 2: 149,405,409 V15A unknown Het
Cttnbp2 A G 6: 18,408,592 F1010S probably damaging Het
Dlg2 T C 7: 92,431,051 V614A probably damaging Het
Dsg1c A G 18: 20,282,047 Y667C probably damaging Het
Ep400 A T 5: 110,708,861 probably benign Het
Fam83c C T 2: 155,831,062 probably null Het
Fbxw20 C T 9: 109,221,300 C419Y probably damaging Het
Fgd2 G A 17: 29,376,930 V521I probably benign Het
Frrs1 A G 3: 116,883,199 probably benign Het
Gli3 C A 13: 15,725,471 Q1148K possibly damaging Het
Hdac5 G T 11: 102,204,656 probably null Het
Ice1 C T 13: 70,604,895 R1024H possibly damaging Het
Irak3 A T 10: 120,182,546 I99N probably damaging Het
Klhl31 A G 9: 77,650,074 D24G probably damaging Het
Lrba C T 3: 86,350,304 Q1292* probably null Het
Map1a C T 2: 121,289,765 A44V probably benign Het
Mrc1 C T 2: 14,248,890 H241Y possibly damaging Het
Mrgprg A G 7: 143,764,694 F227S possibly damaging Het
Ncapg2 T A 12: 116,419,236 L229H probably damaging Het
Ncf4 G A 15: 78,250,437 E30K probably damaging Het
Nlrp4c C A 7: 6,066,778 D559E probably benign Het
Nxpe4 T A 9: 48,396,555 W320R probably damaging Het
Olfr1346 T C 7: 6,474,515 L135P probably damaging Het
Olfr503 T A 7: 108,545,083 M184K possibly damaging Het
Olfr519 T A 7: 108,893,879 H176L probably damaging Het
Pdzrn3 A G 6: 101,151,005 V900A probably benign Het
Prcp T C 7: 92,917,834 probably benign Het
Prkaa2 A T 4: 105,036,329 D474E probably damaging Het
Prl3a1 A G 13: 27,259,617 probably benign Het
Ptpra T A 2: 130,544,952 Y624N probably damaging Het
Ramp1 T C 1: 91,223,300 V129A possibly damaging Het
Reep1 G T 6: 71,756,437 probably null Het
Robo3 C T 9: 37,424,632 probably null Het
Sapcd2 T A 2: 25,376,410 I403N probably damaging Het
Sdk2 T A 11: 113,838,609 probably benign Het
Serpinb3a T C 1: 107,047,174 M210V probably benign Het
Slc45a3 T A 1: 131,981,529 I488N probably damaging Het
Tnrc6c C T 11: 117,758,041 P1513S probably damaging Het
Trank1 T A 9: 111,366,290 H1127Q possibly damaging Het
Trim67 T C 8: 124,826,139 V660A probably damaging Het
Ubash3b A G 9: 41,031,497 I233T probably benign Het
Unkl A G 17: 25,205,733 R245G probably null Het
Other mutations in Mbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Mbd2 APN 18 70593300 missense probably damaging 1.00
BB007:Mbd2 UTSW 18 70568877 missense probably damaging 0.99
BB017:Mbd2 UTSW 18 70568877 missense probably damaging 0.99
R1769:Mbd2 UTSW 18 70616619 missense probably benign 0.02
R3915:Mbd2 UTSW 18 70622609 missense probably benign 0.02
R4184:Mbd2 UTSW 18 70617979 missense probably damaging 0.99
R4854:Mbd2 UTSW 18 70568735 missense unknown
R6056:Mbd2 UTSW 18 70580803 missense possibly damaging 0.91
R6722:Mbd2 UTSW 18 70580748 missense probably damaging 0.99
R7930:Mbd2 UTSW 18 70568877 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAGTAGGAGGCCATTGAACTGAC -3'
(R):5'- AACCATGTGAGAGCAGCAGTTACAG -3'

Sequencing Primer
(F):5'- GACTTCATTATTCAGCAGCACTG -3'
(R):5'- TGAGATGGAAACCCCTTTGTTC -3'
Posted On2014-04-24