Incidental Mutation 'R1597:Atp1b1'
ID 175842
Institutional Source Beutler Lab
Gene Symbol Atp1b1
Ensembl Gene ENSMUSG00000026576
Gene Name ATPase, Na+/K+ transporting, beta 1 polypeptide
Synonyms Atpb-1, Atpb, sodium/potassium ATPase beta subunit
MMRRC Submission 039634-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.739) question?
Stock # R1597 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 164264678-164285924 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 164265889 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 291 (R291S)
Ref Sequence ENSEMBL: ENSMUSP00000027863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027863] [ENSMUST00000191947] [ENSMUST00000193367] [ENSMUST00000193683] [ENSMUST00000193808]
AlphaFold P14094
Predicted Effect probably damaging
Transcript: ENSMUST00000027863
AA Change: R291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027863
Gene: ENSMUSG00000026576
AA Change: R291S

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 3 298 1.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191947
SMART Domains Protein: ENSMUSP00000141431
Gene: ENSMUSG00000026575

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192710
Predicted Effect probably benign
Transcript: ENSMUST00000193367
SMART Domains Protein: ENSMUSP00000141777
Gene: ENSMUSG00000026576

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 1 132 2.7e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193591
Predicted Effect probably benign
Transcript: ENSMUST00000193683
SMART Domains Protein: ENSMUSP00000141963
Gene: ENSMUSG00000026575

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193980
Predicted Effect probably benign
Transcript: ENSMUST00000193808
SMART Domains Protein: ENSMUSP00000141771
Gene: ENSMUSG00000026575

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Meta Mutation Damage Score 0.4593 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that comprises a subunit of an ATP-metabolizing enzyme responsible for transporting sodium and potassium ions across the plasma membrane. This enzyme regulates the electrochemical gradient of these ions in cells, and plays a central role in osmoregulation and signal transmission in nerves and muscles, among other biological processes. The encoded protein is the non-catalytic beta subunit; it works together with a catalytic alpha subunit and a gamma subunit. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac tissue exhibit age-related cardiac hypertrophy and reduced cardiac function, insensitivity to ouabain, and increased heart dysfunction following aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,229,983 (GRCm39) probably benign Het
Afap1l2 T C 19: 56,902,881 (GRCm39) N748S probably benign Het
Aox1 T A 1: 58,086,326 (GRCm39) I77N probably damaging Het
Ap1s1 A T 5: 137,072,095 (GRCm39) M20K probably damaging Het
Atad3a A T 4: 155,835,892 (GRCm39) probably null Het
Birc7 T C 2: 180,570,974 (GRCm39) V12A possibly damaging Het
Btnl2 T C 17: 34,582,211 (GRCm39) V259A probably damaging Het
Cdh11 A T 8: 103,377,343 (GRCm39) N434K probably benign Het
Cel G T 2: 28,450,479 (GRCm39) probably benign Het
Col10a1 A G 10: 34,271,074 (GRCm39) K349E probably damaging Het
Ddhd2 A G 8: 26,239,768 (GRCm39) V315A probably benign Het
Dnah17 C A 11: 117,994,324 (GRCm39) probably benign Het
Dock2 T C 11: 34,595,474 (GRCm39) T441A probably benign Het
Ermap A T 4: 119,041,152 (GRCm39) I286N probably damaging Het
Fbxl17 T C 17: 63,794,813 (GRCm39) K423R probably damaging Het
Frem2 T C 3: 53,561,940 (GRCm39) T856A probably benign Het
Gas6 T C 8: 13,543,901 (GRCm39) E64G probably damaging Het
Gzma T A 13: 113,232,331 (GRCm39) N190I probably damaging Het
Ifngr1 C T 10: 19,485,090 (GRCm39) T363M probably damaging Het
Itga7 A G 10: 128,782,732 (GRCm39) T690A probably benign Het
Kif15 A G 9: 122,823,074 (GRCm39) E485G probably benign Het
Kif18a A G 2: 109,123,336 (GRCm39) I203M probably damaging Het
Klhl1 A T 14: 96,438,647 (GRCm39) probably null Het
Lrch3 C T 16: 32,770,781 (GRCm39) Q128* probably null Het
Lrriq4 C G 3: 30,705,037 (GRCm39) P355R probably damaging Het
Mcm10 A T 2: 5,003,563 (GRCm39) H551Q probably damaging Het
Mcm3ap T C 10: 76,319,060 (GRCm39) F763L probably damaging Het
Mdc1 T A 17: 36,156,758 (GRCm39) V55E probably damaging Het
Me2 A T 18: 73,931,016 (GRCm39) N92K probably damaging Het
Mtss1 A G 15: 58,815,560 (GRCm39) S667P probably damaging Het
Mup5 A T 4: 61,753,317 (GRCm39) Y15N possibly damaging Het
Mx1 T A 16: 97,256,329 (GRCm39) M197L probably damaging Het
N4bp2 C T 5: 65,964,483 (GRCm39) T844I probably benign Het
Nlrc3 T A 16: 3,781,859 (GRCm39) R517W probably damaging Het
Nos3 A T 5: 24,573,995 (GRCm39) I227F probably damaging Het
Or52a5 A G 7: 103,427,267 (GRCm39) F95S probably benign Het
Pabpc2 A G 18: 39,906,953 (GRCm39) N73D probably damaging Het
Pcdhb18 A G 18: 37,624,820 (GRCm39) R717G probably benign Het
Pcsk5 T A 19: 17,413,964 (GRCm39) M1702L probably benign Het
Plxna2 A C 1: 194,431,614 (GRCm39) probably benign Het
Polr2a A G 11: 69,630,755 (GRCm39) M1221T possibly damaging Het
Polr2b A G 5: 77,473,948 (GRCm39) D384G probably damaging Het
Ppl T A 16: 4,925,438 (GRCm39) H67L probably benign Het
Psmd5 A G 2: 34,757,035 (GRCm39) L63S probably damaging Het
Psme1 A G 14: 55,818,222 (GRCm39) T150A probably damaging Het
Rapgef5 C T 12: 117,621,940 (GRCm39) R33C probably damaging Het
Rela G A 19: 5,695,359 (GRCm39) R295H probably damaging Het
Rpe65 T A 3: 159,320,421 (GRCm39) V326E probably damaging Het
Scn5a C A 9: 119,391,563 (GRCm39) R43L probably damaging Het
Skida1 T C 2: 18,051,143 (GRCm39) probably benign Het
Slc4a4 G A 5: 89,283,587 (GRCm39) A469T probably benign Het
Spaca7 G T 8: 12,630,991 (GRCm39) E48* probably null Het
Syn3 G T 10: 85,970,908 (GRCm39) T238K probably benign Het
Taok1 A G 11: 77,470,626 (GRCm39) S60P probably benign Het
Tecpr1 A G 5: 144,151,128 (GRCm39) I256T probably benign Het
Tenm4 T A 7: 96,552,196 (GRCm39) probably null Het
Tex15 A G 8: 34,061,511 (GRCm39) T588A probably damaging Het
Tgfbi T A 13: 56,780,004 (GRCm39) probably benign Het
Tmem62 G A 2: 120,814,843 (GRCm39) A169T probably benign Het
Tnc A G 4: 63,924,621 (GRCm39) S1026P probably benign Het
Tnik T C 3: 28,658,418 (GRCm39) S568P probably damaging Het
Trpm6 A T 19: 18,804,888 (GRCm39) I947F probably damaging Het
Ttc27 T A 17: 75,170,402 (GRCm39) L832Q possibly damaging Het
U2surp C T 9: 95,363,793 (GRCm39) probably benign Het
Ube4a A T 9: 44,841,064 (GRCm39) D1009E possibly damaging Het
Unc13d T C 11: 115,965,262 (GRCm39) E192G probably benign Het
Vmn2r71 T C 7: 85,273,352 (GRCm39) V722A possibly damaging Het
Zfp386 T C 12: 116,023,709 (GRCm39) S476P probably damaging Het
Zfp644 A T 5: 106,786,199 (GRCm39) V116D probably damaging Het
Zfyve16 T A 13: 92,644,755 (GRCm39) N1149I probably benign Het
Other mutations in Atp1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Atp1b1 APN 1 164,285,330 (GRCm39) missense probably benign 0.34
IGL01801:Atp1b1 APN 1 164,265,918 (GRCm39) missense probably damaging 1.00
R0941:Atp1b1 UTSW 1 164,270,829 (GRCm39) missense probably benign
R1034:Atp1b1 UTSW 1 164,281,057 (GRCm39) critical splice donor site probably null
R2202:Atp1b1 UTSW 1 164,281,084 (GRCm39) missense probably benign 0.01
R3811:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3817:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3819:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R3880:Atp1b1 UTSW 1 164,270,874 (GRCm39) missense probably benign 0.00
R4420:Atp1b1 UTSW 1 164,281,127 (GRCm39) missense probably damaging 1.00
R4945:Atp1b1 UTSW 1 164,265,867 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCAATACTTAGGGGCCAGAACAC -3'
(R):5'- ACTTTGGGATGGGCGGATACTACG -3'

Sequencing Primer
(F):5'- TGCTCACTACAAGTCAGTTACGG -3'
(R):5'- GGCGGATACTACGGCTTC -3'
Posted On 2014-04-24