Mutagenetix > Incidental Mutation

Incidental Mutation 'R1597:Plxna2'

175843

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

039634-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1597 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to C at 194749306 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000027952

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 91.1%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	A	T	19: 34,252,583		probably benign	Het
Afap1l2	T	C	19: 56,914,449	N748S	probably benign	Het
Aox1	T	A	1: 58,047,167	I77N	probably damaging	Het
Ap1s1	A	T	5: 137,043,241	M20K	probably damaging	Het
Atad3a	A	T	4: 155,751,435		probably null	Het
Atp1b1	G	T	1: 164,438,320	R291S	probably damaging	Het
Birc7	T	C	2: 180,929,181	V12A	possibly damaging	Het
Btnl2	T	C	17: 34,363,237	V259A	probably damaging	Het
Cdh11	A	T	8: 102,650,711	N434K	probably benign	Het
Cel	G	T	2: 28,560,467		probably benign	Het
Col10a1	A	G	10: 34,395,078	K349E	probably damaging	Het
Ddhd2	A	G	8: 25,749,741	V315A	probably benign	Het
Dnah17	C	A	11: 118,103,498		probably benign	Het
Dock2	T	C	11: 34,704,647	T441A	probably benign	Het
Ermap	A	T	4: 119,183,955	I286N	probably damaging	Het
Fbxl17	T	C	17: 63,487,818	K423R	probably damaging	Het
Frem2	T	C	3: 53,654,519	T856A	probably benign	Het
Gas6	T	C	8: 13,493,901	E64G	probably damaging	Het
Gzma	T	A	13: 113,095,797	N190I	probably damaging	Het
Ifngr1	C	T	10: 19,609,342	T363M	probably damaging	Het
Itga7	A	G	10: 128,946,863	T690A	probably benign	Het
Kif15	A	G	9: 122,994,009	E485G	probably benign	Het
Kif18a	A	G	2: 109,292,991	I203M	probably damaging	Het
Klhl1	A	T	14: 96,201,211		probably null	Het
Lrch3	C	T	16: 32,950,411	Q128*	probably null	Het
Lrriq4	C	G	3: 30,650,888	P355R	probably damaging	Het
Mcm10	A	T	2: 4,998,752	H551Q	probably damaging	Het
Mcm3ap	T	C	10: 76,483,226	F763L	probably damaging	Het
Mdc1	T	A	17: 35,845,866	V55E	probably damaging	Het
Me2	A	T	18: 73,797,945	N92K	probably damaging	Het
Mtss1	A	G	15: 58,943,711	S667P	probably damaging	Het
Mup5	A	T	4: 61,835,080	Y15N	possibly damaging	Het
Mx1	T	A	16: 97,455,129	M197L	probably damaging	Het
N4bp2	C	T	5: 65,807,140	T844I	probably benign	Het
Nlrc3	T	A	16: 3,963,995	R517W	probably damaging	Het
Nos3	A	T	5: 24,368,997	I227F	probably damaging	Het
Olfr68	A	G	7: 103,778,060	F95S	probably benign	Het
Pabpc2	A	G	18: 39,773,900	N73D	probably damaging	Het
Pcdhb18	A	G	18: 37,491,767	R717G	probably benign	Het
Pcsk5	T	A	19: 17,436,600	M1702L	probably benign	Het
Polr2a	A	G	11: 69,739,929	M1221T	possibly damaging	Het
Polr2b	A	G	5: 77,326,101	D384G	probably damaging	Het
Ppl	T	A	16: 5,107,574	H67L	probably benign	Het
Psmd5	A	G	2: 34,867,023	L63S	probably damaging	Het
Psme1	A	G	14: 55,580,765	T150A	probably damaging	Het
Rapgef5	C	T	12: 117,658,320	R33C	probably damaging	Het
Rela	G	A	19: 5,645,331	R295H	probably damaging	Het
Rpe65	T	A	3: 159,614,784	V326E	probably damaging	Het
Scn5a	C	A	9: 119,562,497	R43L	probably damaging	Het
Skida1	T	C	2: 18,046,332		probably benign	Het
Slc4a4	G	A	5: 89,135,728	A469T	probably benign	Het
Spaca7	G	T	8: 12,580,991	E48*	probably null	Het
Syn3	G	T	10: 86,135,044	T238K	probably benign	Het
Taok1	A	G	11: 77,579,800	S60P	probably benign	Het
Tecpr1	A	G	5: 144,214,310	I256T	probably benign	Het
Tenm4	T	A	7: 96,902,989		probably null	Het
Tex15	A	G	8: 33,571,483	T588A	probably damaging	Het
Tgfbi	T	A	13: 56,632,191		probably benign	Het
Tmem62	G	A	2: 120,984,362	A169T	probably benign	Het
Tnc	A	G	4: 64,006,384	S1026P	probably benign	Het
Tnik	T	C	3: 28,604,269	S568P	probably damaging	Het
Trpm6	A	T	19: 18,827,524	I947F	probably damaging	Het
Ttc27	T	A	17: 74,863,407	L832Q	possibly damaging	Het
U2surp	C	T	9: 95,481,740		probably benign	Het
Ube4a	A	T	9: 44,929,766	D1009E	possibly damaging	Het
Unc13d	T	C	11: 116,074,436	E192G	probably benign	Het
Vmn2r71	T	C	7: 85,624,144	V722A	possibly damaging	Het
Zfp386	T	C	12: 116,060,089	S476P	probably damaging	Het
Zfp644	A	T	5: 106,638,333	V116D	probably damaging	Het
Zfyve16	T	A	13: 92,508,247	N1149I	probably benign	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGAGCTGTCCTTCTTAAGTACCCCAAA -3'
(R):5'- TGTGTGATATTAGCACTGAAATGCAGGT -3'

Sequencing Primer
(F):5'- ACCTAAGCATTCCACATGGTG -3'
(R):5'- ATAAAAGAAGTTTGCTCTGTGCTCC -3'

Posted On

2014-04-24