Mutagenetix > Incidental Mutation

Incidental Mutation 'R1597:Rpe65'

175855

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

039634-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.230) question?

Stock #

R1597 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 159614784 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 326 (V326E)

Ref Sequence

ENSEMBL: ENSMUSP00000143654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000029824
AA Change: V326E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: V326E

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196999
AA Change: V326E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: V326E

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Meta Mutation Damage Score

0.6702

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 91.1%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acta2	A	T	19: 34,252,583		probably benign	Het
Afap1l2	T	C	19: 56,914,449	N748S	probably benign	Het
Aox1	T	A	1: 58,047,167	I77N	probably damaging	Het
Ap1s1	A	T	5: 137,043,241	M20K	probably damaging	Het
Atad3a	A	T	4: 155,751,435		probably null	Het
Atp1b1	G	T	1: 164,438,320	R291S	probably damaging	Het
Birc7	T	C	2: 180,929,181	V12A	possibly damaging	Het
Btnl2	T	C	17: 34,363,237	V259A	probably damaging	Het
Cdh11	A	T	8: 102,650,711	N434K	probably benign	Het
Cel	G	T	2: 28,560,467		probably benign	Het
Col10a1	A	G	10: 34,395,078	K349E	probably damaging	Het
Ddhd2	A	G	8: 25,749,741	V315A	probably benign	Het
Dnah17	C	A	11: 118,103,498		probably benign	Het
Dock2	T	C	11: 34,704,647	T441A	probably benign	Het
Ermap	A	T	4: 119,183,955	I286N	probably damaging	Het
Fbxl17	T	C	17: 63,487,818	K423R	probably damaging	Het
Frem2	T	C	3: 53,654,519	T856A	probably benign	Het
Gas6	T	C	8: 13,493,901	E64G	probably damaging	Het
Gzma	T	A	13: 113,095,797	N190I	probably damaging	Het
Ifngr1	C	T	10: 19,609,342	T363M	probably damaging	Het
Itga7	A	G	10: 128,946,863	T690A	probably benign	Het
Kif15	A	G	9: 122,994,009	E485G	probably benign	Het
Kif18a	A	G	2: 109,292,991	I203M	probably damaging	Het
Klhl1	A	T	14: 96,201,211		probably null	Het
Lrch3	C	T	16: 32,950,411	Q128*	probably null	Het
Lrriq4	C	G	3: 30,650,888	P355R	probably damaging	Het
Mcm10	A	T	2: 4,998,752	H551Q	probably damaging	Het
Mcm3ap	T	C	10: 76,483,226	F763L	probably damaging	Het
Mdc1	T	A	17: 35,845,866	V55E	probably damaging	Het
Me2	A	T	18: 73,797,945	N92K	probably damaging	Het
Mtss1	A	G	15: 58,943,711	S667P	probably damaging	Het
Mup5	A	T	4: 61,835,080	Y15N	possibly damaging	Het
Mx1	T	A	16: 97,455,129	M197L	probably damaging	Het
N4bp2	C	T	5: 65,807,140	T844I	probably benign	Het
Nlrc3	T	A	16: 3,963,995	R517W	probably damaging	Het
Nos3	A	T	5: 24,368,997	I227F	probably damaging	Het
Olfr68	A	G	7: 103,778,060	F95S	probably benign	Het
Pabpc2	A	G	18: 39,773,900	N73D	probably damaging	Het
Pcdhb18	A	G	18: 37,491,767	R717G	probably benign	Het
Pcsk5	T	A	19: 17,436,600	M1702L	probably benign	Het
Plxna2	A	C	1: 194,749,306		probably benign	Het
Polr2a	A	G	11: 69,739,929	M1221T	possibly damaging	Het
Polr2b	A	G	5: 77,326,101	D384G	probably damaging	Het
Ppl	T	A	16: 5,107,574	H67L	probably benign	Het
Psmd5	A	G	2: 34,867,023	L63S	probably damaging	Het
Psme1	A	G	14: 55,580,765	T150A	probably damaging	Het
Rapgef5	C	T	12: 117,658,320	R33C	probably damaging	Het
Rela	G	A	19: 5,645,331	R295H	probably damaging	Het
Scn5a	C	A	9: 119,562,497	R43L	probably damaging	Het
Skida1	T	C	2: 18,046,332		probably benign	Het
Slc4a4	G	A	5: 89,135,728	A469T	probably benign	Het
Spaca7	G	T	8: 12,580,991	E48*	probably null	Het
Syn3	G	T	10: 86,135,044	T238K	probably benign	Het
Taok1	A	G	11: 77,579,800	S60P	probably benign	Het
Tecpr1	A	G	5: 144,214,310	I256T	probably benign	Het
Tenm4	T	A	7: 96,902,989		probably null	Het
Tex15	A	G	8: 33,571,483	T588A	probably damaging	Het
Tgfbi	T	A	13: 56,632,191		probably benign	Het
Tmem62	G	A	2: 120,984,362	A169T	probably benign	Het
Tnc	A	G	4: 64,006,384	S1026P	probably benign	Het
Tnik	T	C	3: 28,604,269	S568P	probably damaging	Het
Trpm6	A	T	19: 18,827,524	I947F	probably damaging	Het
Ttc27	T	A	17: 74,863,407	L832Q	possibly damaging	Het
U2surp	C	T	9: 95,481,740		probably benign	Het
Ube4a	A	T	9: 44,929,766	D1009E	possibly damaging	Het
Unc13d	T	C	11: 116,074,436	E192G	probably benign	Het
Vmn2r71	T	C	7: 85,624,144	V722A	possibly damaging	Het
Zfp386	T	C	12: 116,060,089	S476P	probably damaging	Het
Zfp644	A	T	5: 106,638,333	V116D	probably damaging	Het
Zfyve16	T	A	13: 92,508,247	N1149I	probably benign	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGCCAACTACATGGACTGTTTCG -3'
(R):5'- GTTCCTTAGGTCACAACCCAGACTG -3'

Sequencing Primer
(F):5'- GACTGTTTCGAGTCCAATGAAAGC -3'
(R):5'- GGTCACAACCCAGACTGTTATTG -3'

Posted On

2014-04-24