Incidental Mutation 'R1597:Ap1s1'
ID175865
Institutional Source Beutler Lab
Gene Symbol Ap1s1
Ensembl Gene ENSMUSG00000004849
Gene Nameadaptor protein complex AP-1, sigma 1
SynonymsAP19
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1597 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137034993-137046135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137043241 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 20 (M20K)
Ref Sequence ENSEMBL: ENSMUSP00000119458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111080] [ENSMUST00000129356] [ENSMUST00000144303] [ENSMUST00000150603]
Predicted Effect probably benign
Transcript: ENSMUST00000111080
AA Change: M2K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106709
Gene: ENSMUSG00000004849
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129356
AA Change: M20K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119458
Gene: ENSMUSG00000004849
AA Change: M20K

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 19 77 1.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144303
AA Change: M2K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120895
Gene: ENSMUSG00000004849
AA Change: M2K

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.2e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150603
AA Change: M35K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115941
Gene: ENSMUSG00000004849
AA Change: M35K

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 34 175 2.4e-64 PFAM
Meta Mutation Damage Score 0.8461 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the clathrin coat assembly complex which links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. This protein, as well as beta-prime-adaptin, gamma-adaptin, and the medium (mu) chain AP47, form the AP-1 assembly protein complex located at the Golgi vesicle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Ddhd2 A G 8: 25,749,741 V315A probably benign Het
Dnah17 C A 11: 118,103,498 probably benign Het
Dock2 T C 11: 34,704,647 T441A probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Lrriq4 C G 3: 30,650,888 P355R probably damaging Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mcm3ap T C 10: 76,483,226 F763L probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
Mx1 T A 16: 97,455,129 M197L probably damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Olfr68 A G 7: 103,778,060 F95S probably benign Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Psme1 A G 14: 55,580,765 T150A probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tecpr1 A G 5: 144,214,310 I256T probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zfyve16 T A 13: 92,508,247 N1149I probably benign Het
Other mutations in Ap1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ap1s1 APN 5 137041809 missense probably damaging 1.00
IGL01621:Ap1s1 APN 5 137041804 nonsense probably null
IGL02661:Ap1s1 APN 5 137037473 missense probably benign 0.01
IGL02850:Ap1s1 APN 5 137041780 missense possibly damaging 0.91
R2257:Ap1s1 UTSW 5 137041779 missense possibly damaging 0.94
R2964:Ap1s1 UTSW 5 137037503 missense probably damaging 1.00
R2966:Ap1s1 UTSW 5 137037503 missense probably damaging 1.00
R5690:Ap1s1 UTSW 5 137037379 unclassified probably benign
R6164:Ap1s1 UTSW 5 137037386 unclassified probably benign
R7650:Ap1s1 UTSW 5 137045533 missense probably benign
Z1176:Ap1s1 UTSW 5 137037470 missense probably damaging 1.00
Z1177:Ap1s1 UTSW 5 137045233 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCAATAGATGCCTTGGTTCCTCACC -3'
(R):5'- TGGGGACACCCAGCATTGACAG -3'

Sequencing Primer
(F):5'- GGACAGAGTGTCACCTCTTATAGAC -3'
(R):5'- CCAGCATTGACAGCGAGG -3'
Posted On2014-04-24