Incidental Mutation 'R1597:Dock2'
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1597 (G1)
Quality Score225
Status Validated
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34704647 bp
Amino Acid Change Threonine to Alanine at position 441 (T441A)
Ref Sequence ENSEMBL: ENSMUSP00000116893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093193] [ENSMUST00000101365] [ENSMUST00000143540]
Predicted Effect probably benign
Transcript: ENSMUST00000093193
AA Change: T441A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: T441A

SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101365
AA Change: T441A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143
AA Change: T441A

SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143540
AA Change: T441A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116893
Gene: ENSMUSG00000020143
AA Change: T441A

SH3 11 68 1.22e-11 SMART
Pfam:DOCK-C2 418 617 1.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154178
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Ap1s1 A T 5: 137,043,241 M20K probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Ddhd2 A G 8: 25,749,741 V315A probably benign Het
Dnah17 C A 11: 118,103,498 probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Lrriq4 C G 3: 30,650,888 P355R probably damaging Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mcm3ap T C 10: 76,483,226 F763L probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
Mx1 T A 16: 97,455,129 M197L probably damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Olfr68 A G 7: 103,778,060 F95S probably benign Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Psme1 A G 14: 55,580,765 T150A probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tecpr1 A G 5: 144,214,310 I256T probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zfyve16 T A 13: 92,508,247 N1149I probably benign Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
Croesus UTSW 11 34721027 missense probably damaging 1.00
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
gildenstern UTSW 11 34732339 critical splice donor site probably null
godsgrace UTSW 11 34695453 missense probably damaging 1.00
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
latest UTSW 11 34756222 missense probably damaging 1.00
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
midas UTSW 11 34294323 missense probably damaging 0.99
muelle UTSW 11 34687538 missense probably damaging 1.00
narrowest UTSW 11 34282652 missense probably damaging 0.98
pier UTSW 11 34689766 missense probably damaging 1.00
Plank UTSW 11 34783795 missense possibly damaging 0.51
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
toothskin UTSW 11 34464922 missense probably damaging 1.00
Touch UTSW 11 34273750 missense possibly damaging 0.95
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
BB009:Dock2 UTSW 11 34267998 missense probably benign 0.00
BB019:Dock2 UTSW 11 34267998 missense probably benign 0.00
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0006:Dock2 UTSW 11 34312453 unclassified probably benign
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1629:Dock2 UTSW 11 34262480 splice site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6191:Dock2 UTSW 11 34231652 missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
R7188:Dock2 UTSW 11 34239675 missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34231677 missense probably benign 0.00
R7247:Dock2 UTSW 11 34714513 nonsense probably null
R7250:Dock2 UTSW 11 34695205 missense probably benign 0.01
R7250:Dock2 UTSW 11 34695293 missense probably damaging 1.00
R7271:Dock2 UTSW 11 34273750 missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34230672 missense probably benign 0.01
R7397:Dock2 UTSW 11 34718989 missense probably benign 0.00
R7464:Dock2 UTSW 11 34695278 missense probably damaging 0.99
R7512:Dock2 UTSW 11 34312542 missense possibly damaging 0.95
R7556:Dock2 UTSW 11 34720951 missense probably benign 0.43
R7663:Dock2 UTSW 11 34721027 missense probably damaging 1.00
R7779:Dock2 UTSW 11 34714455 missense probably benign 0.38
R7797:Dock2 UTSW 11 34282652 missense probably damaging 0.98
R7855:Dock2 UTSW 11 34273698 missense probably damaging 1.00
R7922:Dock2 UTSW 11 34707327 missense probably benign 0.29
R7932:Dock2 UTSW 11 34267998 missense probably benign 0.00
R8013:Dock2 UTSW 11 34705850 missense probably damaging 0.96
R8192:Dock2 UTSW 11 34732339 critical splice donor site probably null
R8244:Dock2 UTSW 11 34695453 missense probably damaging 1.00
R8307:Dock2 UTSW 11 34310362 missense possibly damaging 0.95
R8418:Dock2 UTSW 11 34718968 missense probably benign 0.01
R8460:Dock2 UTSW 11 34230825 critical splice acceptor site probably null
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Z1176:Dock2 UTSW 11 34718924 missense probably benign 0.04
Z1177:Dock2 UTSW 11 34312553 missense possibly damaging 0.68
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acacatacacacacacttatacac -3'
Posted On2014-04-24