Incidental Mutation 'R1598:Ndn'
ID175948
Institutional Source Beutler Lab
Gene Symbol Ndn
Ensembl Gene ENSMUSG00000033585
Gene Namenecdin
SynonymsPeg6
MMRRC Submission 039635-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R1598 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location62346569-62350262 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62348508 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 34 (P34L)
Ref Sequence ENSEMBL: ENSMUSP00000045369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038775]
Predicted Effect probably benign
Transcript: ENSMUST00000038775
AA Change: P34L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000045369
Gene: ENSMUSG00000033585
AA Change: P34L

DomainStartEndE-ValueType
low complexity region 85 106 N/A INTRINSIC
MAGE 109 279 5.95e-56 SMART
low complexity region 299 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Meta Mutation Damage Score 0.1313 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is located in the Prader-Willi syndrome deletion region. It is an imprinted gene and is expressed exclusively from the paternal allele. Studies in mouse suggest that the protein encoded by this gene may suppress growth in postmitotic neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal lethality, cyanosis and respiratory distress. Mice heterozygous for a knock-out allele exhibit abnormal behavior, abnormal nervous system morphology and physiology and, when inherited maternally, postnatal lethality with cyanosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Cul7 A T 17: 46,663,091 Q1434L probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Mon2 T C 10: 123,016,396 Y1024C probably damaging Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Plce1 A C 19: 38,720,996 D1098A probably damaging Het
Psg25 G A 7: 18,532,003 Q16* probably null Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc2a4 A G 11: 69,945,018 V335A probably benign Het
Slc4a9 G A 18: 36,528,371 W62* probably null Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ttll5 T C 12: 85,863,598 V207A probably damaging Het
Ubr7 G T 12: 102,769,894 M358I probably damaging Het
Urb1 C A 16: 90,777,440 V918F possibly damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Ndn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Ndn APN 7 62348733 missense probably damaging 1.00
IGL02332:Ndn APN 7 62348825 missense probably damaging 0.98
IGL02705:Ndn APN 7 62349108 missense probably damaging 0.99
IGL02824:Ndn APN 7 62348834 missense possibly damaging 0.83
R1525:Ndn UTSW 7 62348508 missense probably benign 0.00
R1595:Ndn UTSW 7 62348508 missense probably benign 0.00
R1636:Ndn UTSW 7 62348508 missense probably benign 0.00
R1638:Ndn UTSW 7 62348508 missense probably benign 0.00
R1653:Ndn UTSW 7 62348508 missense probably benign 0.00
R1791:Ndn UTSW 7 62348508 missense probably benign 0.00
R4674:Ndn UTSW 7 62348822 missense probably damaging 1.00
R7202:Ndn UTSW 7 62348961 missense probably damaging 1.00
Z1088:Ndn UTSW 7 62349134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCGCAGTGCTCAGTAAAGC -3'
(R):5'- CATGTCTGGAAACCAGAGGACCATC -3'

Sequencing Primer
(F):5'- GTGCTCAGTAAAGCGCACTTC -3'
(R):5'- TGGTCCTTCACCAACACG -3'
Posted On2014-04-24